Description :
From Genome Similarity Track
Location :
contig_87:22409- 24282
Transcript NameFunction/comments
g12923.t1OWZ01136.1 hypothetical protein PHMEG_00027539 [Phytophthora megakarya

Sequence
1873 bases(100 bases per row)
AGCTGAAACCTAAGACTATCGGTAGCGCGCGGACTCTACTCTGCCTGCAGGCACTCGTGATGCTGATTCTCGGGTAAAGCGTGACAAGGTATTACGACTA
TCTCTTCATGCCCGAAGAATGCAATTTTGCAGTATAGTAGCAGAATTCATGCGCTAAAGAAGTCAGAGAAAACCAGTAGTATTGCTAGATTCCGATGGTT
AGGCTGGGAGATTTACTTGGTGTGCCTTTGGGTATTTAAAGGTGGGACATCAGAGACACGATGGTATCAGGATGATGTGGAGCAACCATTTCATGATACG
TTCACTTGCCATCTATGTTTGTGCGTGGCTTCCACTATTAATATCCATCCAGCTGAATCAATGTTGGCGTAAGAATACCAGTACACGCTACATGTACCTG
GTGAAAGGTCTTTTTACCCATACAAACTAAAGAGAAAGCTGACACTTCAATCGTTCATATAGATGCATGTGTTTCGTACTTGTCGCTCGAATGTCGGTCC
CGTTGAGTTCGGTAGCCAGCTCGCTAACTACCTCCCAGTAAAATGTACTTACTTAGTGCATCTACCAACATGCTGTGATAATCTCATAGACAAAGTGATT
TGCAAAAATGATTAGCAGCGATGCTCTAAATGTAATGAGGACCATAGCCTGAGGCTGCTTCGGTGTCCCGCTGTTCGCCGCGGTATGGAGATAACGTTAA
AGCCTTCTCGCGAGTGAAGTGCACTGTTCGGCGATTGAGTTCACTTCCGTTGGCTCGATGTCCTTTAGGTTTGTTTTTAGCTGACGCACCCGCTTGTTCG
CGGTGAATCCATGAAATTCACGCGATCACCATCGCGCAGGATAATTCATCTGCTCGCTCGTCATTCCGGTTGAGAACGCCGCTCGCAGAATGCTGTGCAA
GTTCTTTAACTTCGTTAAAGTATGGCCTCTGCCGAAAGCACAGCCCAGGATTAGAGATTCTGCACAAACGTGACGCTCCGCGTCTGTTTTGAGTCTTCCC
ACCGTGTTTACGGCTTTATGTGAAATATGTGCGCGCGTGAACCAGAGAGAGCAAGCGTTCTGGACTGGACTTCTCATTCCTCAACTCGCCTCGGCATCAC
CACTCAGTTGTACTAAGAGCCGGAAATGGACACGTGCCTTCTCCGCCCGCCTACCCGCAAGGTCCTAAGTGACGACATTATCAGCGGTGCGGCGCAGCGC
CCCCGCGGCTTTCGGTCGTACGCTCATGTCGAGCAGCCCAGTCGACCGACGTATCCCACCGAGCACGTGGCGATGGGGTACCCCCACCCACTCACGTACT
ACACAACACCGGAACACAACTCGGCAGAAGGACCCATGGACAGGAAGAGGAAACGGCAGGAGTCCACCGACTCCACGCTGATGCTCTTGGCAGTTTCCAG
TGGCGCGGCGGAAGGTGGTCCCGGTACAAGTAACAACCAACACGTCAGCACGGAGTGGCTCATGGCGCAGCAGGAACATCAACGGGAGATCCGTCGACTG
CGCCAAATTCGGTACAGGAAGAAGAAAGAGAACTACGCGAACACCCTTGAGGAGAGACCCACCAGCTGCGACAGGAGATTGACAAGCTGGAGCAGCGTCG
ACGATCGGTCTCCTGCTGTCCCAAGCGAGAAGACGCTCTGGAACGTGGCGGTCGAGTACTTCCGCCTGTTTCGCTACGGTCTGCGCGCCTCGGACTTGTC
GGAGCAAGCGGCCAACTCGTCAGAGCCTCAGCCGTGCGCTCAATTGGACTTCCTGCGAGCGGCCATGGCCCCAGACGTCATGTATAACGCTGGACGCGGC
ATCGACTCGATCATGACGAACTGGAAGTACTTGTCGCTGTGGTTTCAGGACGTCGAGGTCGAGCTGGACGGCT