Description :
From Genome Similarity Track
Location :
Scaffold_7:224086- 230753
Transcript NameFunction/comments
Physo_305235Hypothetical protein
Physo_305236elicitin-like protein
Physo_518513elicitin-like protein
Physo_462584Hypothetical protein

Sequence
6667 bases(100 bases per row)
TATCTCTCCAAAAAAAACCTCAAGACTTCTTTTTAACTGGGCTGACAGGTCGGAAACCTGTGATTTCGGCGAATTTAACTCTTCAATAAGAGGAACATCG
TCGTTGAGACCGACATGGATAGAAAGCCCTGCATCTAGTTTGGGTAATGCCGCTGTATGAAGCGCTAAATGTATGTAGATCTCGAGCGATTTATCCTCAA
AGCTGGCGTTGCCTGGCGCCTCTGCGATGTTTCTTACCGTTATTAATGCAGCATGTAAAAAGCTATATGTATTTGTGTGACCTTTCAGGTAGGGGTTAAC
GATCGCGCATCGCTAGCGATAAGATGACTGACAAATAGTAAGGGGGGCTACGCACCATGTCCTCGTTGCCGAGCGGGGCAAGAAAAGGAGAAGCCACGTT
GGCATTACTCCTTTGATGAACATATTAGTAGATATGTAAAGTTTCAGCATCCCTAGACTCGCCAGGAAAAACCGAATTTATTCTTTTCCCGAGATTCCCG
TACATTAGTGGTTGTCAGACTAGTAGGAGCATTAGCCAATGACAGGATGCGAACTTTGACTACGTTTCCAAGCTCGCTGGATCCAATCAGTCAAAGGGTT
AGGCGACCTTTCGCCTAACCAATCAGGTGACCCTCGCCTCATTCAAAAAGATGCCAACTCGTACTCGCTGGGGGCCCGTGCTTTAGCGCAGTTCGCACTG
CAGCACTAGATGGTCGCTGCCCCCCCCCCCCCCCCACTTGCTGTAATCTGCCTCCGTGGATAGCCAATCCAGGAAGACCTGCAGAGATGACTTGCCGTCG
GTGACCGCATCGTGGTCTTAGAAGACCGGCTTCTTCTTGGTCTTCGCGCTTAGTTCGCTTGCCGCGACGAGATCTTCTTTTGTGTGTCGCACACTCCTTG
GACTCCTAGTAATCTCCTGGAAAGAAAAAGCTGGGGTAAGATCTCTTGTAATGCAGGGGAATTTTGTCCAATAAGATGATGAGATTCTTCTTGGAAAGCG
GCTTGCATCCAACTCTGACAACCGTTGAAGGGACGTCCAGTTAATCCAAAAAATCACGGAGTGAGCTTCTTTTTGAAGACGCCTACTATTTCAATACTGT
ACACGCCCGGGATATGTACTACGATATAATGAGATTTGCGACAACATAATCCCGTGTAACCTCCTTGGCCTGATCTTCATGCCACGCGCTAAATAGCTTG
CAGCAGCGAGACAATACAGGGCGCTATTTGGGGACAACACAAAGCGGTCAAGCAAGTGAGAGGCAACCCAGTAGCGAGTGTGAATCACCAGCAGCAACTC
AGTTTGCAATTTGCCCTCCCAGCAACAACCCCCAACCAACCAACCAAGCCTTCACCACCGCTCAAGCATGCGTCTTTACGCGTCTCGCTTTGCCCCACTT
CTGGTACTTCTTGCTATCGGCGCCGCTGAAGCTTCAACGTGCAAGACGCTGCTTGATTCCGACAGCACGCTGGCCAAGTCCCTTTCGTCCTGGACCGAAA
CAGACTTGACTTCAATCGACTTCAAAACAGTCTTCAAGGAGACCGACACGGCCTTACCCTGGCTGTCCAAGTGCGCCGCAGCCATCGACCCCAAGGCCGT
CTACACGTCGCTCGCCAGCTCCTCCGCAGTGAAAAACAGTATCTCCGCCATCGAAAACTTCGACAAAGATCTCAGCACGGCGAGCGGGTGGTCGAGCATG
TGTACCATGGCCGATGGCACCATCAAGCCGGATGTCGAGACCGTCATGAAGGACATAATCATGGACGCGTTTGATAGCACAGGCGGGTGCTGCGACGACT
TCCTTAGCGAAGTCAAGACGCTGTTCGGCGGGGACGCGCTCGACGACATGGTGACCAAACTCATAGAGCTCGGTCTCAACATTCAATGCAGCGAGAGGAC
GTTCACGAACCTGAAAGGCACTTCGACGAAGGAAACGTGCGCGTACTCCATCTGGAACTCCTTCTCCTTCATCGAGACGGACGAAGATGCCGACAAGCTC
TTGAACCTCGCCCAAATCCCGAACGACCAGATGTGCAGCGTGTTCGCCGGCAAGGAGTTCACCAACACCAATGGCGACACCGCCACGATTGACTTCGGTA
CCAACGGTGTGGACACCATGGGCATCTGTCTCGAGCCCATCGACACGATGACGCAGTACCTCAAGTCTTGGAGCATCTTCTCGGAGACCATCGACGCGGA
CGGCACGAGCGTGTCGCTCTCGGACCTCTTCACCTCAGGCAAGTCCGTCAGCGCCACCCTATTGCTGGATTATGCCGCCTCATCGTCGGGCTTGCCGCGC
ATGAGTCTCCGAGCCACCGAGCAGGTGCTTTTCGCTCTGGGTGTGGCCACCACCGACGACGGCGACAGCGACACCTTCCTCCAGGACATGTTCGTGGAGA
TGCTGGACAGCATCCGTACGTACTTAGAGTCGGTGCTGGTCCACATCCCGAACAACGGCGGCTGCACCTTCTCGGACCAGTCGATCACGCTGCCGTATTC
GGAAGCTGCAGCTGCGGTGAGTACGGGCACCAGTGCAGCCTCGTCGGTCAAGCTGTCGGGCCTTGTGACTGCGAGCGCGGTGCTGGTCTCGTCGGTCTTG
GCTACTCTGCTGTTTTAATCCGGCAGATAGTTCAAGCACATTTGCAAGACGGCCAAGCACCAGCCTCAAACACTATTAAATAATGCATAACCATATCTTC
ATATGAGTTGCATCTTGAATCTTGAATCAACCTCGATCAGAATAACAGCGACAACATACCAATCAACACAAAACTTCACCTTATCATCAAAATCCAGCAT
GCATTACACGTGCAACATTACCGCAGCCAGCCAGCCACTGCAGCAAAGAAGACACCACCTCCCTTCCTCCTCTTACTCCTCGCTCGGCTGCGCAGGCTCC
TCCGTCGTCGTGGCAGCAGGCTGCTGGTTCTCCTCGGTCGTCTCCTCCTCGCCCCTGTCCGCGTCGTCCTCCCGATTGCGGAACCTCGGGTTCTCCTCCT
GCTGCTGCTTGTCGCCCTCCTCCCCACGCGGGGACTCGGGGCGTCTCTGGCGACTGGAGGGTGGCTCGTCCGCCGCCATGCTGTCGTCGCGCGGGCGCTT
GACGTGCGCCGAGCGGCGGAAGTGGTGGCCGTCGGCCGTGGCGTCGTCCCCGCGGCCGTAGCCGCCGCGCCCGGCGTCGTAGTCGTCCTTGGAGCGGCGG
TCGTCGCGCACCTGGCCGCCCGAGAGCCCGCGGCCGAACTGGCGGCCCTCGCGGAAGCCACCGTCCATCTCGCAGCGCACCACGCGGTTGTCCAGCTTGG
TCTCGCTCAGGAACTGCGCGCAGGCCTCGGCCTCGGCGTGCGTGCTGTACTCGACGAAGCAGAAGCCGCACGGGGTCTTCTTGAAGCGGTCCAGGCCCAT
GATGACGCGCTTGACGTGCCCCACGCGGCTGAACAGCTCGTAGATCTGCGCCTCGGACGTGAAGAACGACAGGTTGCCGATGTACAGCGTGCTGGAGCGC
GCCATGGCGCGCTGCTGCTCGGCGAACGAGCTGAAGGTCTTGCGGTCCCAGTACTGCCGCTGCGACGGCCCGCGCGCCAGCCGCTGCTCCTCGTCCGCCA
CCTCCGCGTACAGCTCCGCCATGAGGGTCTCTGTTGGTACTATACCTTTCGAGCAATTGAGCAATGGTCGAGGACGGATGAGAAAGAGTGGATTTTAGAT
GGAGATATGATAGAAGGTAGGTGATTGGTGTGGAAAACAAAATATGGATTATGTGTCTGATAACACGTATTTAGGATCTGCAGGATGGCTTAGGCTGACA
GGCCTAGGACGACGACGAGTTGCGGCACCAGCAGCAGCAATAGCGGGATTGCCGTCTGCGGGGCGCCGGACTTGGAGGCGGGGATGGCGTCGGACGCAGC
GTTGCACGAGCTGATGGCGCTGGAGAGCACGGTGCGCAGGTTGTAGCTCTCCACCTCGCAGGACGGGACGCTGGAGACCATGCTGGTTAGGTAGGCCAGG
CACGCGCTGTCATCGCAGTAGGCCCTCGAGGTGCTCGAGAGGGTGTCGCTGCCGCATACGGCCGTCACATTGCCACTGAGCGTCGAGAGCTCCGCCACCT
GCGCGGACGTGCACTCGGCTGCATCGATGACGGCGACGAGGAGGGACGAAGTCGCGGCCAATAGCACAAAGCAGCACAGGATGCTTGACGCGAGACGAGG
AAGTAGGAGCGGCATCGATGGAGAAATTTGTCACGATTTGGTGTGCGCGCGCTCTAGTCTGATGTGAAAATGGCGGAATTCCAGTGAGGTCGGATGGGGA
CTGACTGTGATTACTTGATCAAAAGTCGAATGTATCCACAATCGTCCGCTAGGATGGATCAAAGGTGTTGGATAGTTTTACACAGTACAGGACATTCTAA
CAGCACAAAAGTTTCTACAGTGCTGCACTCCTGAGCAGAAGCAGTAGACTCGCAGTTTGCAATGCCAAAGCCAACATATCGGCTCCAGAACGCGCGTGTG
GGGCGCTGTTACTGCTGCCGCTGGAGCTTGAAGTGGCTGTGATTTGAGCAGCAAGAGTGGCAAAAATTCCGCTGCGAAGTTCGCTGTCCGACACGGTGCG
GGAGGCTTTTTCGAGCGCCGGGAAAACGTACGACGAGATCTGTCGGACGCACTGGTCCCTCTGCCCTCGGCATAGTGAGCACACCTGCGCGTAGGAATGC
CGCCGGCAGCCGAACTGGGCGTTGTAGCAAACCTCCGCGTTCTCGTAGCAGGGAGGGTTGCTATCTCGCAGAGCATCCAGGTCGGTGGGCAGCTTCTGCA
TGTGGTTCGTCTTCTCGTCCGCTAGCTCGTTATACAGCGCGATCATCTGCCTCGTGCGAGCGAAGTTCGCCTCCAGAGACGATGGGTCCTCCCAGAACGG
GATGCTGGTCACGTTGCTCAGTCCGAGGGTCTTGTCCTGGTCGTACGAGTGGAACTCGACGTTGCCAGCCTTGCAGAACGCGTTGTAGTTCTTGTAGTAC
TTGGTCGAGGCCTTCTGGACGCTGTCAATCGCCGACGCCTCCGATCCAGAACCCGAAGTTGAACTCTCCACTGAAGATGTACTGGTAGCATTGATCGCCG
TGATCCCCACCAATTGATCGATCGACAAATAGCCCAAAATCTTGTACGAGAACGTGCAATTCACTCCATCCGGCTGCCACCCAAAGGGGCACAGTCCTCC
CTTGTGCTGCTCTCGACAGACGTCGCTCTTGCCGTTCGTCCAACTCGACGTCACGCAGCTATTCGGGTACGAGAACCACACCGTGTCGTGGTACGGGGCC
ACCATATCTGCAGAGAACGCCTGTGCCCCCACACACGGGCCGATGTCGGGCTGACCGTCGAGTCCGTTAAATTGCTTGCACTCTGGCGGGTGGTCTCTGC
TCGATCCACTGCTGTCACTAGCCAAGCCGTCGTCCTGCGCGTCAGCATAGGCGCACTCTCCGTCCTGCATCACCACAAAGGGGCAGAACTCCGGGTACAT
GCAGCGCTGCTCCTGGTACTCGGCCAATGCAGCGTTGGGCTGCACGATCTGCACCTCGAGGAACGTGATGACGCTCACGTTGTTCCTTCGGTGGCAGCCG
CTGGCCGTCGGGTCCGCTCCCTGATCGATGCAGTCGCGCTGCAGGTACATGAGCGCGCCCTCTACGCTGGAGGTGGTGATCGAGTCCATTGAGGCTCGGT
AGCGCTCGTCGAAGGAGAAGTTCCCGCTGGATGGGAGGCCCGACACGAAAACCTGCTGGTCAGCGTCCCACACGGGCGCGTACGTCTCCACGCGCGCCTG
GTACGACGTCACCGTGCGCATCGACCACGCGTCGACGCCATGCAGAGCGCAGCTCAGCAGCAACGGCAGCGACAGCCGCGCCCACTTCATGGCGAGACTC
GGAATGCCGGAGTGTAATGAATGACCTGCTGAGCTTATCCGAATATCAACAGCCGGTTTCAGAGCCGTTATTGAGACTCGCCATTTTGAAGACTCCTTAT
TACGGGTATTGATGCTGGTCCACGTAAGTAACGGATTTTCCCGAATACAAGACCTGTAGGAAATAGAAGTCCGGTCAGAAATAGGTTGGAGTGCCTGAAA
ATAGAAGTCCCGAATAAAATAAAAGACCGGACATCTATTTTTTATAAAGGTACTCGAACATTTAGCTTTTAAATGTTAGCCCAAACTCTGTTTGCTTTGG
AGCTCGCGCTCATTCCAACCCTATTGGATTTACTTCACAACGATACGATGTACCTGGAAAAAGCAATGAATTGTGGTCGTCAACCGATCTCGCTACATGT
ACTCCATCAGCATTGTTGTCTTAGACAAAGATCTGCATGTAAACTACTAAAGAGGATGAAACTAAACGACTGTTAATCTCTTTCGTGACGAGCAATGAAC
GCCTACTTGCACTTTTGCAGCGTCTTGCACAGCCTAGAACTTAACGAAGTGAACGAAGTGTTTGGGCCTCACACCTACCCTTGCCCCAAACACTTCGTTC
AAAACCATTTTAAGTTGCTGCTGCTACAAGTGCAGGGCAAACGGATAGCGGGAGTGGTTAAACTCCCACGGCTTATGTACTCGAGGGGCTGCGTCTTACC
CAAAAGCTTATCAATGTGAGCTTGAGTGTACCTCCAGGCACCCTGATTTAGCGACCCTACTAAGACT