Description :
From Genome Similarity Track
Location :
Scaffold_405:2240784- 2242106
Transcript NameFunction/comments
Aphin_H310_04282Radial spoke head 10-like protein B

Sequence
1322 bases(100 bases per row)
GAAGACGCTTGACTGCCTTGTTCTGCGCGTTCCGCACGACGAGGAGCTTTCGGTTGAGCTTGCCCATGCTCGCATTGAGCCGGCATTCCACAGCGAACCG
CCACAGCTCGCGCATCTCCATGAGCACGTTGTTCTCCGAGCTCGCATACGGCGTCGTGGTGCCAGCGCACGACGCGTAGTGCCGGTACACGTTGCGCAAA
TCCGTGTTCACGCGAAGCACCTACCATGGCCCACGAGAAATCCAACCACAACGTCGTCAAGACGCGTACGGCGTTTTGAGCCGCTTTGAGACCCTTGGCG
CGCTCCCGCTCGTCGCCGCGCAACAGATCGTCCACGTACAGCAAGATCGTCGGAATCGCTTCGGCCGACGACTGTTTCCGGTTGTCGTTCAGGTCGACCA
TGCGATCGTGGACGAACTCGCCTGCCCGCCGTTCATTTTGAATCAAATGTACAAACGGATCGCGAATCAGAACCGCACCTTCGTAGATCGTGCCGTCTTC
AAAAAAGAAGAGGCCGAGGCCGTTCTTGACATTGGCGTCCCAGTGGCCTTCGTACCGCGCGCCGTTCGCATAGTGAAAGATCCCGTAGCCGTCGCGAACG
CCGTCGGCAAACTCGCCTTCGTACCGGTTGCCCCGCTTCTCGGACGCCTTCCACACATGGACGCCGTAGCCGTGCTGCTTGTCGTCCATCCATTCCCCTT
GGTACTGTTCCATTTTGTCAAACCAGTGCATGGTGCCTTGTCCGCACTTCACGCCGTTTTCCCAACGGCCTATCCCGTCCATTCAAATACGGCGCGGCCA
CGATGCATCCCTACCTTCGTACACGTTGCCGCTCCCATACTTCATCGTTCCGTGGCCATCCCGCACACCGGCCTTCCACTCGCCGTCGTACTCGATTCCG
TTGAACTCGTCGTACACCATGCGCCCGACGCCGTGTTGTTTGCCATCCATCCATTCGCCTTCGTACGTCGTAATCTTGTTGCTGCTCTGAAAGAACCCGT
GGCCGTGGCGCTTTCCCCCTTTGACCGCGCCTTCGTACCAGCTCTCGTCTGGCCACAAGTACCTCCCTTGGCCAGAGATTTCGTTGTATTCGAAATCGCC
TTCGTACATGACGCCGTCGGGCCACTCCAACCGCCCGCGTCCGTGCATTCGCCCGTCGCAAAACTCACCCTCGTACACTTGCCCGTTCACAAACGTGGCG
TGGCCATGGCCATGGAAGCAATGGTTTGCGTTGCGATCGCCGTCGTACTCGACGATGATGAGCGCGGCAAGCGCTGGGTCGAGTGGAAATTGGGGCGCCG
CCATCACGAAACGCTGTCGCCA