Description :
From Genome Similarity Track
Location :
Scaffold_197:22400- 23701
Sequence
1301 bases(100 bases per row)
CCAGCTCACTCTTGGCTCGTATCTTCTGATCCAAGGTAATCCCAGGATGAAATCAAATTTGTCATCCAGATCCAGTACGATGAAATCATCATCGTACTGT
TCACCCTCTAACGTGTAATGAAGTCCCACTACGCGCTTCTTCAATGTTATTGATGCGCCTGTTGCTAGGCACACCGTCATCATCGTTTGAGGGATGCCGC
GCTCAACGAACCTGAGCCTACGACCCTCTAGCGACTGACGACGAACAAAGTTGCTCGACGCCCCACAGTCGACTAGAGCACGAAGTGACAAATCATTTGT
CACCTTCAATTCCAAGGTGATGAGTGATACCTCATCAACAGGTGCAGAGACACACAATAATTGTGTATCTGGAGCAACTTTCGTCAGGAGATTTTCAAAT
TCTCTTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACCCCGACCATTTTTGATGGTCCACTTAGCTGTTGCGATTTCGCAACAGCGTTAGAC
CTACGCCCATTGTCCTTTCTGGCGAATGGCCAATCATTTCGCTCTGTACTGTTTGGTACTGGGCGTGGGCACTACACTCGTAAGCGTAGTATCCCAACTT
TTAGCAGCGATTGGACTTCTGCAATCGCTTGTTGTTCGAAGAGCGAGGTCTCTCGCTCTCGACATAACAGAGGTCCATTGGTTCTGGATCTCCAGTCTCT
TGTCGTCTCGGTGGACGATAAGAACTCGAGCTAGCATGAGCCTGTCTCATGCTAAAGTCCTCCTGTTCCGCAGCTGAGATTGCTTGTTCAAGCGTATCCA
ACTCTAAGCGGAACAGGTGGTTCCTGACGGGCCAGTCTACGAGCCCTTGCATGAACACAGTAATCAACGTGTTCATGTACTGGGTTAGCAACTATACTAC
TCGCGAGGAGTCGTATATGTTGAGCGTAAGCGTGCACATCACGCTTACCCTGCTTGAGTTTCAGGAGCTCTGATCGATCCCTGAACTCAGCCCGTGGCGG
CTCAAACGTCTGTTCGAGTCGAGGTTTGAAGGCTCCAGCGACCCGAAAGCATATGGGTCGCTCATCTCCAGCCCTAAGGCCCAAGTCTTGGCACGTCCCG
CCAAGTGGGTTTGAGCAAATGTGAGTTTGATTTGCTCATCGTCGATACGTCGTGCCTTTATGGCTCTGTCTAATTCGACGAAACATAATAACAGGGAGTA
TTCCTCGACTCCTCTGTACTTGGAGATATCAACCTTTAATATTTCGGGACGACGCGTGTGTGTCGTCCCGCCCACAGCAGCATTGAATTGCTGCTGTCTC
A