Description :
From Genome Similarity Track
Location :
Scaffold_1295:2240- 5573
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1295-snap-gene-0.3Nucleoside diphosphate kinase

Sequence
3333 bases(100 bases per row)
TCGTACCAGTCCTTGGTCGTGTGGAGGCCGCGCCAGCCCTTGAGCGGCCGCTCGACCGTGTACTGCGCAATGCACTGCAAGACGAGCTCCTTCTCGAGCA
CTTTGAGCACGAACCACGCGGCAACGACGAGCAGGACGCTTTCGCGGACGTAGTTCAAGTAGACGAGCCCACAGACGAATGTGACGACAAGGTTCACGAT
CGAGCCGAGCGTCCACACGGCAAACTAGGGTTTGAAGAAGAAGATTGTGAGACGGCCAGTATTCACGCAAGGAGAAGAGGGAGCGGACTGTACCAGTTTG
CCGTAGAAGACGCTTCTCCGCGTGAGCGAGACAAGGCCAAGAAGCGGTGCCCCCGGCACGGCAAGCGGCAGCACGCTCAGCACAAACACAAACGCGACCT
GCGACAAGGGAAAGAGAGAGGTCAGAGATTCACGAGTGTAAGGCAAGCACGGAATATAACTACGTACGCGAGAGCAGCCCGAGTCGTGGGCCGTGGGGTC
GTCGACTTGAACGCAGTAAAACTCCATGAGCACCCAAAAGATTGCAATACAATCGCCCAGCAGCAATAGCAGCATCAGCAGCGGCAGGACGAATGGCCAT
GTGCGGATCGCCCGTGGGCGCAGGTTGCGCAGACGAAAGACTGGTGTCAATGGGCGTAGTGCCGCCGCGAGCCAGTGGAACGTCGCCGAGTGCGGCGCGC
ACAGCAAGAGATCAGAGACGGTGGTGGTCGCACTGGCGTCCTGGCTCGAGCGGCGCCGCCGCTGCTTGGTGAGATGCAGCGGCTGCTGCGGGTCGTCGGA
CCCTGCGGGACTCGGCTGGTCAAAAAGCGCCTCCATGCGGATGGATGAATACCGAAACTCAAAGGGGCGAGGGTCTTCCGTGTCTAGCGGCGCGTCAACG
CTGGAAAGATGGAGATCGGCAGGGAGCTCCTGGCCGGAAGCAGGCTGTGGCTCGAGCTTCGTTGAGAGAGCTGGCACTACCGGTTTGGTCACGAGCAGTG
CAAACTTGAAGGGCTCCAGCGGGAAGGTTTCAAGCCGCGCAAGCACGTCGCTAGTGTCGAGCTCTGTGAACTGCGCACAGGACTCGAGGGTGCCAAACTG
GACGCGCATGCCGTCGGCATTATCGGTTCGCTTCTTGTTGAACGCTGCCACAAACTCAAGGATGCTTTGCAGTCGGACCGCGATCCGCTCTCGCCGTGGG
TGGGACGCCGACGGCTGCTGCACGAGCCGCAGGCGCTGGTTCATCTCAGCGACGAAATCGATCCAAAACTGGTGCTGCAGTAACTCGAGTCTTGCCGGCA
CGGCGCGCACGAGCGCATCGTTTGTATCGACATGGTAGGGCCGGAAGAACGACCCACTGCCGGCGACCGCGATGGTCATCGCTGATGGGGGCACTATCTT
GTGGGTAGCGTCTTTCTCGGGTAGGCGTGAACGTGCTAGGGATGGCGTCGCTGCCGCCGAGCCAGTCAGCCCAGACGCCGTCGTCGGTGCGATGACATCA
AAGTACGCGAGCGAAAAATCCGGGCTGAAGCCAACCTTGAGCTGTGCGCCATGGCGGCGAAAGCCCAGCTCTCTCACAAAGCCTCCCGTGTACTGTGTGA
CGTGGAGCGCGAGCTTCTCAACTCGGTGCAACTGCCGCTTGCGCAGAAACAACGTCGCAAACGGCGGCGCGAGCACGAGCAAGACGCGGTGTGTCCAGCA
CTCCCAGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNTCGGGCCACGCGACGAGTTCATTACATGACGTCGCGAATGTTGCGAACGCGTCGTCGTCTCGC
ACGAGCTCCTTGAGCTCCGGGGGCATGCCGAACGGATCCAACACCCAGGCGCTGAACAAGTGGTTGTCGCCCGAGAAGTAGAGACGCGTCACGTGGTTCG
TGAGGTCATGGTCGGTCAGGCGTGGCGTCAGATTTTTGGTCAGATTCACGAGGGACTGTTCGTCTCGCTGGGTCTGGGCCTTGTACTGGGCGAACCGCTG
CTTGAACTTCTGGTCAGCACTCGTCCGGAATGTCAAAAACGCCCAGGAGCCGACGACCACAGAGATCAAGCTGAGGACCAGAATGGCAAACCCCAGTGGA
CCGCCAATGGGCTTCACGAACCGTTCAAAGGGTGTGAGGCAGTCGAGACCGTTGCGGCCTTTCTCACAGGCATATGTGCACTTACCCCGGACATTATAGA
CCGAGTGGTCGGGCTTGGTGCGGCAAGGCGCACAGTGTAGTGATCCCGGCATGGCGGTTGTCTCGCCAATGCCACACACCGTGCAATTGGTCGCACCAGA
CGTGATACTGATCGTGCCCTTTGGGCAGAGTAGGCACGCTGGTGATCCGGGCTTGTCGGCAAATGAGCCAGGTGCACAAGGACCGCACGCTGTGGCACCA
GGCTTGGTAGCTGACGTCCCGGGGACACACGCTTCACACTTCTTCTGACCGAAATCGTGATTGAAATAGCCCTTGGCACACTTGGAGCAGCTCCCCACAC
CAAACTTGTCGGCGTATGAGCCCGGCTCGCACGGCAGACAATGCGGCTGGTCGCCGGGGCTGAACGCGCCCGGTTCACACAGACCACAGAGCCCTCCGCC
TCTTCCGATCGAGCAATTGACCGCCGTGAAGATTCCAGCGCCACCGTTTTCAGCGCCTGTGCCCTTCCCGCCACCGAAAAGAACCTTGCCTCCGCTCGTG
ATGAACGCGTCACCGTTGCCTGCTGTGCCTGGCTGGTCGCCTCGAAAAAGCGTGCGAACGATACCACCNNNNNNNNNNNNNNNNNNNNNNNNCCGCCACC
ACCCGTCTTGGCACCAACAAACGGCCACGACGGCTCCCATACTAAAGTGCCGTTAGATCCCCTGTCCAGCAGCACGGCTGCCCCAAGCGAATCCCCGCCC
GATACATCGACAACACCACTGCCCAGCACCTCGCCCACAAAGACACCAATGGCTCCACCGGCACCGCCGCCGCCATTCTTGGTACCTATCGCGCCTCGCG
CACTGACAACGGCGGTCGCGCTGCTAAACGCCAACTGCCTTGCACCGAGGTACACGATGCCGCCGCCATTTCCGCCTTCGATACCACTTGATCCATCACC
CGCCGCGGCGCCACTACCAGGCCACACGGGCCACGCCGGTGGTCCGTCGGCCGTGGCGAGATGTGAAGGTGGACCATCATAGGCTTTGCCTCCCCCAGTG
TTCCCGGGCTCGACGTTGCCGCCCTTGCCGCCGTGGCCAGCACCCCCGCTTGCACCATTGACGACTTCGCTTGTACCGGGTCCGGTATTGGCCGCACAAC
CGAGTCCGTCCGAAGTCACGCGTCCTTCGACAC