Description :
From Genome Similarity Track
Location :
Scaffold_539:224- 3492
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_539-snap-gene-0.7Transmembrane protein

Sequence
3268 bases(100 bases per row)
AaCCTTTGCGCGgTGCTCCACATTGGCCATGCGTTCGCTTCGTCGGATGCCACGGCGCGTCCTCGTCGTGCTGGTCGTGAATTGGACCGTGTGGATGCTG
ATGGCGGCGATCGTTTGCTCTCAACTATCTGCTGTTGTCTCCAaGGCcGCAGGGgACAAGACgACGCAGAAGATGGGACGCAGCCCGCTACTACCTGCCa
CAAAACTGGCTGGAACTAACGACGAACCGTATTCGGACCGAGCGATAGTGTGTGTGCAAGCGTCCGGGTCTTACGCACCTCTTGTACTCAGCACCGCATT
AAAGAGCTCGAGATATTTGACTGATGTGGCGACAGACGAACCAAGGATAAACGGACTCCGATTCGtGAAGAGAGAACCGCAGCAGCGAACAATAAACTCA
CAAGCAGCAAaGCGGtACACTGACGCTTGTCAGCACATTGCGATGTCGCTAGaCGCAATTCAGGCCGTATGTGACTCGATCGGATACAATGTCTCCAGGC
AGAAACTACGTATATTCGAACATTGCCTATCGTGATCCTGCCGTTTTGGGACAACGCGACTTCTGCACACTACATCCTTCCAGGAGCAGACGGCACACCA
TGCATGTtGCGACTCCGCAGTCGGTACGAAACCTTCGGGgTAAGTTCTGCATTTGCGGTTGGTGTCCCGAGGAATGATTATACCAATAAGACGGTCGAGT
GGTTGGCGAAGCCAAGGGGAACGTGGCGCAATGGCTGGTACGAGAGACCCGGATGGGGGAAGGTGGTTTGCTAACATAGTGACCACTAAGCAAACTGAGC
TGGGAATCCGGTCAATTCAGTTTGATATCCCGTCGCTCAAAGCACTTGACTGTGATGAAACGAACGCATGTAGCGCCGGTGTCGCTCTCGACAATTGGGG
TGCACGTCTGCAACAGACAGTGGAGATGGTCAACGAGACGCAGGTCTTTGTCACTAACGGCACGCGCTTCGGGATATTCTTTGTTGAAGCCAACCTCCGC
ACATCGATTAGCAACTCGTTCTCGCTTGCTCCCTTTATCTCGAGTGTCACCATTGCGATGCTTCTATTgCGCTGgTTTGTCTCGATGGCTGTTAtGTTGA
ACAGCTTCATCCGAGGATCGTCGACcGTCCCCACGATTGGCATTGGCTGTCTCTCAATCTCCAGGGCATTCCGCCTCcTCCCCGTTGTGCTCATGgCACA
GTTGATAATGCGGTTTGCTACGTTCTGGAGTGCGGGGTGCAACTACCAGGGACAACAGGCCGCACTTACCGACTCGTGGTTTGTCATGTATCTTGGTGTT
GTCGAGTACGTTGTGATTTACTTCAGTCTGCTCAACATGTCGGCGACGTTGCTGCATCGCCGAATGAGTGACGCGACTTTTGCACCAACCCTTGTTTTCT
TCTGTGCACTTCACTACTGCCGTAAATCGATTtGGCTCGGTGAGATCCTTGGCTTTGagACTGCAGTTCCACCGACCTTTTCATCGGATGAGTTCGAGGC
ACTTAGTTTCATGGACTACTTCACAGCTGATCTCCTGATCCGTTTCAACGGGAACAACCTGCGCCAATTCAATCTCAAGTTGGTTATACTCATGCTCAGC
TCGACGCCATTTGCCTTTGCGGAGAAGGTGACAACAAGTGGGAAGAAGTaCAAAACCCATGCGCCGTGTGAGTTTGAAGAGGCGATTGCTCTTCAGGCAT
CCAATTTGGGCGGTCTTGGGCGATCCAGAATATATGAACGCGATGCAGATGACGATCAGTTGATACCGGCGTCTTCACAGCCTACGCCAAACTCCAGAGT
TCGCCCAGAAAAGGGGATGTCGTGACTAAAGAAGTCATTTCAGACCATAGACTGAGTGCATACGAGGTGAGCCGCCTTGGATTTCTGGTGCTTGGCGGCA
AGTACTTGATGGGATTCGAAGACTGGTACACGCTTTTTTCCATGGCCCCAATGCGATCTCTCGAGAAGCTGTGGAACCAACGTGTGACTGTGTGGGACGT
CTCAAAGTCAAGTGATACCTTCCGTGTGAGTTCTACACCTCGCCTGTGCCGCCTAGATGACCCACAACTTCCGCGTATCCCTTTCTTCGATCTGACAGTG
TGCTCGTTTCGATAGAAAATGTAGTCAAGCCAAATGAAAAACGATAAAGGATGGAATTGGAAATTAAGAGTTTGCTTTGGGGGgCCTATGGAAATGAACA
CATTGTGAGGTCGTACATGGCGATATTCTTGAGCTCTGGATCTTCGATGCGGCACATTCGTAGTGTACGGCTTGCGCGAGCCACGCCGTCCTCTTTCGAG
TTATCAAACACTGCGATGCGCTGGTTCCAGAGCTTCTCCGCAAAGCGTAGAGGCCGCATCAGCAAGAGTGTGATCCAGTCGGCGAAAGTGATGAGGTAGC
GGTCACCATACACAACATACCCAAGCCGAAGCAACTCGTAACCCAAAACAGCACACCCAGATCCCCTCGTGCTGGCGGTAGATGGGTCTTGCGAAGGCTT
TGCAATACTACGGCGGAAGGTCACAAGGCTGCTGATTGGAGATGGATCTCGAATATCATGCACTTCTTCAGGGACATGGGAGATCTCCGGAGCTAAAGGC
TCATAGACTTTCGACCTACCGAGTCCGCCGACGTTGGATGCTCGCAATGCGAGTGAGTACTCGATCTCACACGAACACAGTAAACGATGCTTCCCACGAT
GCTCAGTCATATTGTCGCCAAGCACCAGGGGTAAAGTGAATGCAATGAGCAGAGACAGCTTAAAGGCGTACATGCGAACAGCGTTCCCGCAAATCTTGAT
AGCTGCTCGCGGGGAGAAGAGATCTAAAGTACCCATCGCTTCAAATTCTTCCGATGATAACACAGTCGGAAGTTCACCTTCAGCTCCGAGTCAGCCAGTC
GTACTCAGCCATTCGCGGTTGTAGTGCATGAAACAAATCAACAAAATAGTCGGCGAACAGAACGCATCACTCATGAGATAATGCAGGACCTTGGCCATGG
CGTTGAGGACGGAAAACGATACGAAAACGTACTCGATCATACCCGAGTACATGACAAACCACGCGTCTGCAAAGATGCGCTGTGGGCCGCCTATACGACA
ACCAGCACTCCAGAACGCTGCCAATATGGACTTCATATGTGGTGTAGCGAGCACTGGTAGCGCAGTGAACACTTGGCTACTGGATAGACAGGAAATACCG
ACACTCGGGCGTGGGGACCTGCCCATTCGGTAGCTTCGAATCGCAATACGAAGTGACACAAACCACCG