Description :
From Genome Similarity Track
Location :
Scaffold_1339:224- 2683
Sequence
2459 bases(100 bases per row)
AGGAAGGTAAGCTGCTAAAGGTGTGGATAGTACAATGTTGCACTTATTTCGTCCCGGAGGAAGTAGATAAAACCGTGTTTAAAAAAGACAGACATGGAAT
CTTTATCTTACGTTTTAAACATGCAAAAAGGACGATCGATTGCTGAAATCCAAGGCTGTCGTAGTTCGATTTATTAGCCTGCATAATAAATTAAATGACC
TGGTAGGTGAAAACGCAATATTAGTAATTTAAAACTGCTAAAAAGTGCTTTTAAAAAAAGCACTTAGAAACACATTTTTGAGATCACATTATAAAATAAA
ATGTCTTCCACAAAAAATTAAGGACCTCTGAGAATCGATGCAGATAGTGTGAGACTACATTTTGATCTTCCTTGGACAAACAGCGTTCTTAAATCCCACC
CTTGGGAGGGATGACATAGTGAGTGGGAGGTAAAATTTGTTTTTTGTTTAATAGCTGACTTTATGGATTATTTGAATATTTGTCAATATTTAATGTAATG
TAGTACCCAAGTTCTGACATATGCCTTTGTACAAAAGCGGAATTGAGGGTTAGGAAACAGAGGTCACGCGATAGCATTACTTATTAAACATCAGCTCTAT
GCGAACCTGAAGCAGTGTACCTTCGGGGCGAGCGAGATACCCGTCCTTTGGTGTCCAACAGCGTACGCCCAGGCCCAGAAAAGGTCAGAGTGATTAATGA
ATGGCCTATGCCATCCAACGTAAGGGAACCGAGGCAGTGCCTTGGGCCTGCAACCTACTTGTCCAAGTACACCGATAATTACGTGGGCAAGATTCGCCCG
CTGTCGCAGCCTCTTAAGAACAAAGCTGAGCAAATTTGGACTATCGAGTGTTAGCAGGCCTTGGATACAGCCAAGCAGAGTTTGACAGAGGCGCTTGTCT
TGGCAGCGGCTAACCCAGATCGCTCATTCCACGTCGTGTGCAGATAGTGACCCTGAAACCGGTTAGCGGTGATGACGGGAAGAGCTACAGATACCGTATG
CGAGGCACAACGGCGAAATATCTCATAAAGAGCTAGAGCAGAATCGGAGACAGCAGCTAGAGGGTGGGAACGCAGCCGATAGCAGATTTTCTTGTTCATC
CGGTACACTACAATTATGCTAACAGCGATTCCTTTGGCGGCGCTAGTGAGGCACCGCCTTAACCGCTTAGTGATGTATGAGAGCAGTAGTGTGGAGGGCA
TAACCGCAACTATGTCTTCAGCCGAGTCACTCCCACGTATCTGTGCACTTTCTTGCCACGCAAGAGTGTTGGCACTCTACTTGCGTTTGGCTTGGAAGAA
TGAAGACTGTGTTATGTAAGCCAACTGGAGTGTAGTATGCATCCTTCTCCTGTGAGAAGTTTGCTAACTCCTCGTTGCGTCCGCTTCTTAAGCGGTTTCC
TAACTGTTCATGAACGAAGAGATCTTTGCTATCTAATCCTTGTGTACGACGTGTCAAGATTTCCTGATCTCATGCAACGCCCTCCGTGTTCCGACAATGC
TGCCCCGATCAAAGCTGTCATGAGCTCATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN