Description :
From Genome Similarity Track
Location :
Scaffold_1730:224- 2150
Sequence
1926 bases(100 bases per row)
CAACTTTCAGCTTGGGATAAGTGTACTACAGGGAACAAGCGATATTTCGGTACCTGCCCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCTCAC
CCGGAACGGTCCATGCCATAGATGGGCCAATTTTGCGGGCGTACCCCTTCTTTCACTCGATCCAAATAAAAGCCACACCTGCGATCCCACTTGGATTTGA
TGTGGACGGGCGTCTTCGTTGTGTCGATCCCGCTCGCTCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGG
ACTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCACCCATGTACCAA
GTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGG
ACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCA
GGATCCGGTTGAATGCTCGAAAGAATTCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTC
GTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCAAGTATCCGGTAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCT
TTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCC
TGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGT
CCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCC
CGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTT
CCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGCTTTGTGCTTTGAGGATCCGCTCAATACGGACTCC
CTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCTTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACT
ACCACCACTTCGTCTAGTCGGCTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATCGATTCCGTAAAGCGGCACTGGCCA
AGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACACGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAG
GGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAA
TCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCC
ACAGTATTGCACTGTATGCTCCCCCGCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGG
GATCTGGATCCGGCGTTTGGGCTCTT