Description :
From Genome Similarity Track
Location :
Scaffold_3244:224- 1467
Transcript NameFunction/comments
Phyag_g13145PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1243 bases(100 bases per row)
ACGGCCGGCGACTGACGAACAGTACGTGCTGGAGTACGTAcgaggagttcaaggaggagctcaagctAGCGTTTGAGCCTCCACAATCGGAGTTCAGATC
GAGGGCGGAATTCCTCGATCTGCGCCAAGGCAAGCGTGATGTGTTGGCTTATGCCCAACAAGCACGATACTTGGTGTCAACTATCGTGACCAACCCAATT
GATCAGGCGACACAAGTTGTCACCTTCATGAAGGGTCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCGAGTACCCTCGAGCAAGCTA
TACGGCTTGCTTCGCAGGAAGAGTTTAGCCTGAACCAGGCTAAGATGCACGCGGACACGCCCGGGGCGCCACGTCCGCGTCCGAAGCCCATGGGTGGACC
TAAGCCCATGGACTTGTCAAGTGCGTCTGCTGGCAGGCAACAGACTGGCCCGCGTAGGACAACGCCGAGCTGTTTCCGGTGTGGAAACAACGGCCACCAC
GCCCGCGAGTGCACGGCAGGTCcgggagctgcagctcgcggtaCGTCGTACCGCACCAACGGTCACCGTTGGCGCGGNACAGCCCCCTGTGACGCCCGGC
GTCACAGTGAAAAGAAGGATGATCCAGCCGGGTTGATCATCCTGGAGGTAACAGTGCATGGCAGACGCATGCACGCGCTGGTCGACTCAGGCGCATCGAA
CAACTTTGTCCGACTGCATAGCCTGAACTCGATGTGTTCCGAGGAGAGGGAATCTCCTCGAAGTGAGCTGGTTGTGCGCCTGGCGACAGGCGCAACAGTG
AAGACGCGCAAGCGAACTGTGAGAGTTCGCTTTGGATGTGAAGGCAGGACCTTCACAGAGGACTTCATCGTCCTGGACTTGGACGATAAGTTCGACATGA
TATTGGGCATGCCGTGGCTTAAACGCCATGCCCCAGTGATAGACTGGAAGGCCCAGTCTATTGTATCGTTCGGCTCCGAGGACGCATGCGTCCGCGGTAC
AATGGACAACGCGACAGAGAGCGATGGCCCTGTCAGCGTTGCGTGTACACCGCGAGGTGTGCACGTAGAGAGTGAGGACACCCTCACTCATCCGAGCCAA
TCGATTACGTCACCCGCCGCTACCGGCGAGCGAGTGAAGAAGTCGGGAGACCTCCGGGAGGCTCCCACGTCTGCGTCCGGGACGCAGGCGAAACCAATGG
CGGAAGACCTCCAGTAGGCTTCCTCACCTGTGTCCGGGACACA