Description :
From Genome Similarity Track
Location :
Scaffold_26:223985- 229093
Sequence
5108 bases(100 bases per row)
CCCACGAGGTCGCCCAGACCATAACTGAAGAGAAGACGCGAATGCGTATCCTGTGTGGGTAACATAGTACCATTCAAGGCCTCGAGTGCCTCGGATGTCG
GCACCACGACATCCTCAGACGTGGGTAGCGAGCTTCTACGTCACGGATGCCGTCAGCGACGCCGCCGCCGCCGCCGCCAAGAGACGAATCCGAACCTCGT
TCAGATCGCCGCCGCTTCAAGCGACCCGAAGCTCAGGGCCCGGGCTCCTCCGACACGGCTGATGGAAGAGTGTTATCACATCTTCGATGGAGACTGGTCT
ACTCGTCAAGGCATCTGGTGCTCGTTTGGAACCGTTGCCAGAGGTCGCAGAAACACTAAACCTTGAGAAAACGATCGTCGAGCTATTTCTGGCGAGCCTC
AAAGCTGGTGAAATTTGCCGAGATGGTGCTCATAAGACCAGAGGCGACTCGGGAGGAGATGAACACTTCCTCTGGCTTTGACGAGGACGTCCTAGAAGAG
CTGAGCAAGAAGCGTCAGACGCGCTTGGGTTCTGAGATCCATAAGAGCCCCAAGGATCCGGTGTATCCCTTGGTGACGGCGTACGCGGACGTGGTGAGCA
AACACCCACCGACTTAACTCCCAACGGATCGAGGCGTACGGCATGAGATTGTTCTCGTGCCTGGTACAAAGTACTGTGTCACAAGGCAATGGCCTCTTCC
ACACGAACAGTGCAAGGTCATCGATGCCTTCTACGCTGCGAAATCGAAGTCAAGGTCCCCGCACTCGACGCCAACTTTCTGTGTTCGGAAGGCAAACGGG
AAGTGGCGTCTAGTTCACGCTTGTTACAAGCCGAACAACGCGGCGGTGCCGTCCCAGACACCAATCCCACGAAAGATTCGTTCTTGAACAACATGACCAA
AGGCGTATTGAACAGTGCGCTGGATTTGGTAGACCGATAGTACCAGATCCTGATGCGCGAGAGCGACACCCCGCTCACCGCGGTGAGCACTCCAAGCGGC
ATGCTTTGTGTGGCTCGTCATGCGACAGGGCTTGTCTAACGCCCTGGCGACATTCAACCGCCTGGTGACGCAGCTATTCAGGCCACTGCGCACCTTCGTA
TAAACGTACTTCGACGGCATCTTCGTCCATAGCCGTACCGAGGGAGGCAAGACGACCATGGAGGTGCATTTGAGGCACATCCGTCGAGTGTTGCGCGTGA
TGCGAGCAAACAGGCTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGATATCAAGGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTTGAGC
TGACCTAGACAAGGTCGAGGCCATTTCAGCATGGTCAACTCCCCGATCCCAGAAGGATTTTCGAAAGAGGTTGGGCTTGACCAACTACCTTCACAAGTAC
AGTGTAGGGTACGCGAGCCTCGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACACCGACTGGCGCTGGGAGCAAGAGCACCAGGATGGCTTTGACAGCA
TCAAGGCCAGTCTCCTAGAGGATCTTGTCCTGGCCCTGCCGGACGAGACAAGGCCATTCAGCGTCGTCTGCAATGCCTCCGACTATACGATCGGCTGTGT
ATTGCTGCAGGCCGACACGGCTGGATCATCTCGCTGCAGTCCATGCAGCACAAAGCCGCTAAACGGAGATACCCTGTCCATGACAAGGAGCTCCTGGCAA
TGAAGTACGCCCTTGTGAAGTTTTGGGTTCATCTTCCCCACGCATCCTTGAGGACGACGACGAATTCGCCTCACCTCTCCCTACAGATGGCGAGGTGGCT
GTCCTTCTTCGCGGAGTACAACGTCCGCGTTGAGTACAAGCGGGGCAAACTCAACGTGCTTACGAACGCCCTCTCTCGGCATCTAGACTACGAGTTGGCC
CACATCACACGGGTGACAATGGATCTATATGATTGGATACGCGTGGCGTATCGGGACGATGATGTTGTCGCGCATATCGTCAAGGTCCTGGCAGCAGGAG
CAAAAGCAATATTCGACTGGCTCTTGTCGCGACAGCGTTCCCGACTCCACCGATATGAGGTGAAGGATGACCTCATCTATTACAGGGTGGAGCCTAGTGA
ACATCCACAGTTGGTCGTACCCAACGACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCGCACGATGGCGGCCACTTGGGTCGCGAGAAAACCTTCCTG
CCGGTCTCTCAGGCCTTCTGGTGTACAAGTGGGTAGCCCGATATGGGAAGACATGCGGAACATGTCAGCGGGTTAAACCCGCAGGACACGCTTCGTCTCC
GTTACAGAGCCTGCCCGTTCCGGCTGACTGTTAGAAGTAGATGAGTCTTGACTTCGTATTTGGGTTTCCCGCCGACGGACACGGCAACACGGGGCGTTTG
GTGTTCGTGTGTCGGCTGAGCAAAATGTTACATCTTGCTCCAGTACCCGTCACTGTCACAAGCAAACAGATATCGAGGTTGTACGTCGATGGCGTGTTCC
GATATCACGGTCTCCCGGAGACGATTATCTCGGACCGAGACCCGCGGTTCACGGCTGCGCTCGGAAATACGCTGTTTCTTTTACTGGGAACTCGTCTGCA
GATGGCCACTGCGGACCATCCGCAGACAGACGGCCAGACGGAGCGTGTCAATCGAGTGCTCGAGGACACTCGGCGCAGTGTGTGTGCTGAAGCACCCCGT
CCGTGATCGACGCAGCTTCCTGTTGTTGGGTTTGCGCTCAACATCGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACGGCTCCCGTCACC
CCAGAGGGCCTCTCACTCTTCGAGGAGACGCTGCCTCCTCTATTCTAAGTGGGGGAGAGGCGCGAAAAGCTCTTTCCCCCAGGTCTGAGATGTAAGACCG
GATTCGCTGCGGAAACAAGTGGAATCCTTTGTGGATAACAAGCTGAGCGTGATCAGCAGAGTCCGCGATGCCAGGGCCGCGGCCCAGGGTAGACAAAAGG
AGTACTCAGACAAACATGGAAGATGAGACTTCAGTGTATTTAAAGTGGAAGACTTAGTGCTATTAGACACGAGGAACCTGTCAGCTCTGTCGGCAGCAAC
AAACTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCCCTGGTGCGTCGTACACCATAGATCTGCCTAAGTCAATGACGACGCACCCGGCGCTCT
ACGTTGGACGTCTAAGCGGTACCAGGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGCCCAGCTCCTCGAACTGAGGTCCGACCACAGACGTCA
CCGAGTACGTCGAGTACGGACCATAAGCGTACGGCTGGGAGTGCACCGAACGCGGCTCCGGACGTAGCAGCAGAGCATCAATACGTCGGATAATGAGGAA
GGCCTCGTCAAGATCGGACGAAGAAGCCCGTTGGTCCACCCGCAGATGCAGGCTCGAGACCTCACGCCCTAACAGATCCAGGCGGCCCGTAAGACGAGCG
AGCACGCCCTGATTCCCAGTTTGGGCGGCAGCATCACCACCAGTCCCAAGGACAAGTGCAATCTCAAGCACGAGGACGCGTTGACTGAGGCGGTCAACCT
CAGGGTCCTGCGCCGAACGAGCAGGAGAATCAATCGGACGTGAGTAGCGTTCCGGAGGCGCCTGGTACTCGTACTCGTACGAGGGCACATGAGCCCCTGC
TTGACCGGAACGTATTCTCCAGGTGTCATGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGCGTAGGGGCTATGCCAGCCTCGAGATTGCGTGGGAGCCG
ATTGAGCGGCTCCTGGTAGACTGCTCGAAGACTATCGCAATCTGTGAACAGAAGCGGCGGCAGCTTCGTAAGTAGTCCGGGGCTTCTAGCCCGAACGGGT
TGCGGACGTTGACGACACTCCATACCTGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTTAGAATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGG
GCGAACCGGACACGAAGATCACACTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGGGTTCCCGTAACTCCGAGGGTGAGTACTTGAGAGACTCAA
CCCACGCCCAGAACATGTCCTCACACGAGTTCCAGCTGGGGCAGCTCTCGCGAAAAACCCAGGGGTAGCCCCAGAGAGGGTAGAGACCACCCCGGTTCTC
GGGCTTCTTACGACAAGTCGTGAAGTTCTTCAGAGGAATTCGGTGCGCGCGAGAAGCACGCACCGGGCCGCCTCCAAGTTGGCGGCGAACAGCTGCTCCT
TCTGTACCAGGGCATATTCGTTGACGCCCTTACAAGTGTGGCCACCGACAACACCACAAGGAGCGACGAGGATCTCCAGAAAGTGGTCAGCCCCAGATCT
GTTCTCGGGAGGCCAGTTACCTCGTGAGTTGATAACAGCTCCCTGGTTGACAGGTGTCACCACCGGACCCCAGCGCATGCGATGGGCAGCTTGGAAGTCC
TCCTGCTGCTGATCGAGGTGGTTCGTGATCTACCGAGGCTCATAAAAACGCCCTCCTCTTCCTCTTTATCTGAGGAGCCGAAGAGGTTCCGATAGGAGTA
CCTTCTCCTCGCGAAGTGGAGACTTCGAAGCCGTGCGCTTCTTAAAGGGACTGGCGTCTTCGAGTGTGGTTTTGGCGGCCTTAGCACACGCAGGACCCTC
GGCGAGTGAGAGGTGTTCGGGAGGTTTAGAGAGAGCCCTTAGTCTCGACGACCGGACTCTTAGGGGGCACAGACGTCCTGGAGCTGTGATCACCTTGATC
ACTAGCGGGCGTGTGCACGCTGTCGTCGTCGTGCTCGCTGGGCACTGTAATGTGCCCTCCCACGGAGCCCTCAGGAGCGTCGTAGGTGCTCCCGGACTCG
ACCTCGTCCTCACTGCCCGAATCGAACTCAACTTCAGCGAACCGCGGGCTCGATCGGTTGTCTGGAGAGACCTGTGGTGACGGACTGCGGCGCTTGCTTG
CACGCTTGCTCGCAGCCGCGTCACCAGATGAACCGATTTCCTCCAAGGCCACCTTCGTTGCATCCTGGAGTGCAGAGCCTTTGGCGCGAGGCTTACGGCT
CTTGGCTT