Description :
From Genome Similarity Track
Location :
Scaffold_313:22397- 25490
Transcript NameFunction/comments
Phyci_165358Hypothetical protein
Phyci_256896Hypothetical protein

Sequence
3093 bases(100 bases per row)
AAGCCTTCGGCGTTCGGGCGTAGATCTTTTATTGACGACGTCTTGGTGACCGCGAGATCGTGGGATCGCCTGTGCGAGTGGGTGGACGATCTACTGGAGG
CGTGTCACGAATGGAATATCTAGATTAGCGTGGTGAAGCGTTTCTGGGGCAGATCCAAGGTGGAATATCTAGGCCATAAAGTATCCAACGCAGGCCTGGA
GGCGAATCCCAAGGGCTATCTGCCTTGGTggacctgccgttcccgggatcactcagatccatgcagtcgttcatcggaagcttaagttattacagtcggt
ttatcgaagactacgcgatttacgctgcgatcctttatgagctacgagaggtggatttcgTCGCGATGTCAAAGGCGGAAGCTCGGGCCCAGATCAAGGC
ACATCTGGATGAACCCACCTTGGCTCACATCGGATCACCGAGTTGGGATCTGGAATCGGATGATCTTGGATCCACGTTTGGTGAAACCGCACAACCGAGT
GACCTGCATCCCAGCGGCATTGCATTAACTCCACATGGAGGCGAACTTCCCAGATCAGCGCTTGAACAACAAGCATCGGGATATCCTGATTTGGTAATAC
CGGATCTGGAGGCACGTAATCAGGAGGTACCGGATCTGAGTTCTCGTGGTCCAAGGACAGGTGATCTGGGCCCAGGCGGTCTGGGGAAGGTCTATTCCCG
Ttggatccgagctcaccgggcgtatactaagctgaagagcaaggttgcttcgactctgatcttgcgtcacttcgactctgacctacaaccagtagtggtg
gtgtatgcgaatgactgggtgatctcggctgccctgatgcaggaacacgatgggatctaccatcccgtcacctttgtgagccgcacgttgaaacccaatg
aactcaattacgggattgtcgagaaggaggtgttagcgttgctattaatcttggatctgagctaaaatatgttggttggccgcccaatcaagatactaac
caggtactctacactgccgtggctcttcagataactggggctgcaaggacgcctgggacagtgggctgccctgctctctccgtggacgcccgagatcgtc
aagtgtacgaagggcgaatcgtggggggcaagcgctaccagcatcacacccagatcacaagtggatcaggtcctgatagcgattgcgccgaagaaggaac
ccaggcaccagatccaagcaccgatcccgactgtgcggctagatgaggaatttttcgtggtcagcttcgagggatccgcccgcgtcaaacgtagtggagg
cgcctacagcacgctcttatggtagctgcccgagtggagtgtggtaaaagctagatccggctatgctgaagggttgactgtcaatgaagccgagtaccat
ggcctcctgctgtgcatggatctaatcgagggtgaagatcggcttaggctggtgatctgtggagactcaaacctggtgatccgccaagtgagaggtgaga
tcgactgcaaagtaccagggcttacactattaaggcaaaaggccctagatcgacttcggatatggcacaatctcgggctggtacacgtcaagcgctactg
ggacggtagcgctgatagtctaacgagtaccgtgctccaacgacaaggcggtatcctggtcgacgccgagacggctctgcaggatctggtcactctgaat
cgactacacgagatactggtggttaggaaggaggaggacatttcggtcgctcgagtttcgccagcaaccaccagatcgaaggctagatcCAGATCCACAC
CTACCGTCCTACAAGAAGCGGTAGTGAGAGAACTGATGatcgatcggatccggcaagctcaggacgaggaggcgtggagcttcgggttgaaggactattt
ggcggcggcggcgcaagatctgatgcaggatgaggccagatcctatggcaacattagcatggattacgaggtggatctctgtgatctgctgttctactgc
cttcctacgaagcgatcggaggcggatcgcgatggattgatgcgattggtgattccggagacactccaacaggatgttctgcatcactatcacgcgagtt
tggaaggtgaccatcaagggatcggacgcaagaatcagaagatccgagatcgcttccactggagatgtctctattggagcgttcagcagtatgtcggtga
gtgcgtggaccgcgagacgggcaaggggcgaccccggatccagggtgagtcgcccggtaacatccagacaacctacccgttccagatcatagccatggat
cacatcccgtcgttgcccaaatcctacaatggtaacacggagctgctgatctgggtggatctgtttatagggtatgtgatcgctaaagctagcgcctcga
gaacggctcaaacgctcgcggggtcatacgaggagtgcgtgttcaggagattcggcgccagcgaagcgatccggcacgaccgtgagccagggtttatgtc
cgacttcttcagatcgttcaaccggagctgaggacaatggcagcatgccactatggcttaccccccccaggccaacggcacggctgaacgggtggtgcaa
accgcgatcagggcactcaagatgtacgtgcaggatctggatgagcgtgattgggacgataacgcggaacgacttaccttcgggaccaacaccgctcagg
atcggatcCGAGGGGAAACCCCGTTTTATCTGGTGCATGGGtgggatcctagatccaccttggaggcgactatcgcgctaggcagcagtcgacgtcagga
tcgagatcctcggaggtggagataccagatccagcgctatttccaacaggcacgagagcaagtcgatgacaagttgcgagaggcgacctcggaacgggta
gatcagcataatgaaggagtacacccgcaccagatcgaggtcggatcccgtgtctggttatacctggatcgcgtcaaagaaggatatgctcggaagttga
cgcatctctggcacggcccattccatgtggcggagaagatcggcgaatatgcagctcggatcgagttatcaggcacagagtaccgcctcgtcc