Description :
From Genome Similarity Track
Location :
contig_96:22394- 24271
Transcript NameFunction/comments
g10855.t1hypothetical protein PHYSODRAFT_509857

Sequence
1877 bases(100 bases per row)
CGTCGGAGCGCGGAGCAGCGCGCGATTCGCTGTGTATTGGCATTCTGGCGTCTGATTCAGGACTTTAACGGGGACGTATTGCAACGAATACTTCGCGTTT
CGAGGCGGTTTTCGCGGTTGAAGATAGATTGGCGTGCTGCGCACACGTGGAGAGGGTTGGTGTAGCGCTGCGGTGCGTGTGAGCTCTGCTGCAGCCGTCG
CAAGAGGCCGCCGAGGTCGTCCTGAGTGCGCGCGTCCATGAAAGGAAACGAACGCGCCCTTTTCGTCCAAGATTGCGGAACGATCTGATTTGACGGGGCT
GGGTAGAATACATAACATAGGGTGATGTACACTATTTAGCGGCTACCAACAGATCGTCGGCTGAATTTCAACCAATGTCAACTCGAATGAGATCGCAGTT
TTGACCAATAGTGGCACTTCCACGACGTCGTGGATTCCGGCTCGCTGTGTTTCCAGAAGTTCAAAGGCACAAAACAAAGCGCAAGCCGGAGGAGCTTCGG
TGCGTGCTACTTTCTTCCCCCGTTCGTTCTGCACGTCTGTTTGTGTGTCTAGCCGCTGGTTAACCCCTCGATCTCTAGTGTCTGCGTGTGTGTGTGAAAC
AGCGGCGTCCAGATCTTCCCACAAGGAGATTTAACGTCGGATATAGTGGAAAAGGTGCGAAAACGAGAAAAAAACACGGCTAAAAGGCGCTCAGAGCGGC
GTTTAAACAGCTTTCTAGCAGCTATACAAGCTGCAGCAGCTCGCCCTGCATCATGCAGCGTGGTCGCGTGGCGCTGTATGACCTAAATGATGACCTCGTC
ACTGATTTTATGACATTTGTGTCGGTTTTACTCGGTTTTAGCAGTTTCTACAGGGTAAACAAGAACAAGATGGAGGCTATCGGCCAGAAGCTGCTGGATT
TCTCGCAGCCCTTCGATGTGGCGGCGCTGGACCAGGTGGTGCTATGCATGAACGACCCCAAGAGCCCCACCAGCGGGTGGCCAACCAGATCATGGTGGCG
CTGCAGGAACACCAGGACTCGTGGACGCGCGCCTCTGACATCCTGGAGCAGTCCAGTAGCATCCAGACCAAGTTCTTCGGTCTGCAGGTGCGGTGATAAT
TGTTGCAGTTGTGACACAATTTGGAGACTCTGACATGCATTTGATGGGCATCAGATCTTGGAGGACGCGATCCGCTACCGCTGGAAGATCTTGCCCAAGG
ACCAGCGCGAGGGAATCAAGAGCTACATTGTTGGAAAGCTGCTATCGGTGCGTTGGCGTTGGTTTATTTTTTATGGCGATTGATAGAGGTGCTGATTCGG
GTGGGGTGTATTGGTTGTGTGCAGCTATCGTCCGATGAGTCGACGCTGCACGGTCAGCGCATGTTTGTGAACAAGATGGACCTCGTGCTGGTGCAGGTGC
TGAAGCACGAGTGGCCGCAGAACTGGCCGTCGTTCATCACGGACATCGTCAACTCGAGCAAAACGTCGGAGATCTTGTGCGAAAACAATATGACGATTCT
GAAGCTGCTGAGTGAGGAGGTGTTCGACTTCTCGAAGGACCAGCTGACGGAACAGAAGACCAAGTCGCTCAAGGAAAGCCTCAACCACGAATTCACGCAG
ATCTTTCAGGTACGATTGAACGCACGGAGAAAGCGCGGTTCGTGTGGCCACAATCGTCTTCGATCTCAACAACGCTAACGTTATGTTTTTATTCTTGCTG
TCGATCCTGCTACCGTAGCTGTGCGAATTTGTGCTGAACAAGTCGACACACGTTCCGCTGCTTCAGATTACGCTGCAGACACTGCTTCGTTTCCTGAGTT
GGATCCCGCTCGGTTTCATCTTTGAGACGGACCTCATCAAAATCCTTGTCACAAAATTCCTGGCGACGGGCGTGTTC