Description :
From Genome Similarity Track
Location :
contig_87:22394- 24267
Transcript NameFunction/comments
g10497.t1conserved hypothetical protein

Sequence
1873 bases(100 bases per row)
CGCGGACTCTACTCTGCCTGCAGGCACTCGTGATGCTGATTCTCGGGTAAAGCGTGACAAGGTATTACGACTATCTCTTCATGCCCGAAGAATGCAATTT
TGCAGTATAGTAGCAGAATTCATGCGCTAAAGAAGTCAGAGAAAACCAGTAGTATTGCTAGATTCCGATGGTTAGGCTGGGAGATTTACTTGGTGTGCCT
TTGGGTATTTAAAGGTGGGACATCAGAGACACGATGGTATCAGGATGATGTGGAGCAACCATTTCATGATACGTTCACTTGCCATCTATGTTTGTGCGTG
GCTTCCACTATTAATATCCATCCAGCTGAATCAATGTTGGCGTAAGAATACCAGTACACGCTACATGTACCTGGTGAAAGGGCTTTTTACCCATACAAAC
TAAAGAGAAAGCTGACACTTCAATCGTTCATATAGATGCATGTGTTTCGTACTTGTCGCTCGAATGTCGGTCCCGTTGAGTTCGGTAGCCAGCTCGCTAA
CTACCTCCCAGTAAAATGTACTTACTTAGTGCATCTACCAACATGCTGTGATAATCTCATAGACAAAGTGATTTGCAAAAATGATTAGCAGCGATGCTCT
AAATGTAATGAGGACCATAGCCTGAGGCTGCTTCGGTGTCCCGCTGTTCGCCGCGGTATGGAGATAACGTTAAAGCCTTCTCGCGAGTGAAGTGCACTGT
TCGGCGATTGAGTTCACTTCCGTTGGCTCGATGTCCTTTAGGTTTGTTTTTAGCTGACGCACCCGCTTGTTCGCGGTGAATCCATGAAATTCACGCGATC
ACCATCGCGCAGGATAATTCATCTGCTCGCTCGTCATTCCGGTTGAGAACGCCGCTCGCAGAATGCTGTGCAAGTTCTTTAACTTCGTTAAAGTATGGCC
TCTGCCGAAAGCACAGCCCAGGATTAGAGATTCTGCACAAACGTGACGCTCCGCGTCTGTTTTGAGTCTTCCCACCGTGTTTACGGCTTTATGTGAAATA
TGTGCGCGCGTGAACCAGAGAGAGCAAGCGTTCTGGACTGGACTTCTCATTCCTCAACTCGCCTCGGCATCACCACTCAGTTGTACTAAGAGCCGGAAAT
GGACACGTGCCTTCTCCGCCCGCCTACCCGCAAGGTCCTAAGTGACGACATTATCAGCGGTGCGGCGCAGCGCCCCCGCGGCTTTCGGTCGTACGCTCAT
GTCGAGCAGCCCAGTCGACCGACGTATCCCACCGAGCACGTGGCGATGGGGTACCCCCACCCACTCACGTACTACACAACACCGGAACACAACTCGGCAG
AAGGACCCATGGACAGGAAGAGGAAACGGCAGGAGTCCACCGACTCCACGCTGATGCTCTTGGCAGTTTCCAGTGGCGCGGCGGAAGGTGGTCCCGGTAC
AAGTAACAACCAACACGTCAGCACGGAGTGGCTCATGGCACAGCAGGAACATCAACGGGAGATCCGTCGACTGCGCCAAATTCGGTACAGGAAGAAGAAA
GAGAACTACGCGAACACCCTTGAGGAGAGACCCACCAGCTGCGACAGGAGATTGACAAGCTGGAGCAGCGTCGACGATCGGTCTCCTGCTGTCCCAAGCG
AGAAGACGCTCTGGAACGTGGCGGTCGAGTACTTCCGCCTGTTTCGCTACGGTCTGCGCGCCTCGGACTTGTCGGAGCAAGCGGCCAACTCGTCAGAGCC
TCAGCCGTGCGCTCAATTGGACTTCCTGCGAGCGGCCATGGCCCCAGACGTCATGTATAACGCTGGACGCGGCATCGACTCGATCATGACGAACTGGAAG
TACTTGTCGCTGTGGTTTCAGGACGTCGAGGTCGAGCTGGACGGCTTAAAAAAGTGCGGCGTCGACGCGCTGA