Description :
From Genome Similarity Track
Location :
Scaffold_2264:2239- 3837
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2264-fgenesh-gene-0.0Conserved hypothetical secreted protein

Sequence
1598 bases(100 bases per row)
GTTTTCCAAGCTCGTGTTTGACCAAGTTATCTCGGACGACGGGACCAAAGTGGTGCGCCGTGTGCCCAGCGGTGTGGACGCGGCTTTTGCGCTCCTTGGG
AACGACGCCGCGAGCAGCGTGCTTGCCCAGCGCATGGCGGCGTCAGCCGAGACGAGTGACTTTGTCAGGTTCCGGGACGGTCTCCCCTATACGCCCAGTC
TCATTGCGACCCGCCGACTCGTCGACGACAAGCTCCGCCAGGCGGATGCGTCGACCAGCAGCGTGGCACTGCTGTGGCAGCTTGCTCTCCGGGAACTGTC
GGCGCCCAGCGCCAATGCTGCGCCCGTCTTCCAGTCCGACGTGTGGCAGAAGCGGCAGATGAACACGCAGCTCGCATCCCTCACGCAGCTGCGCCACGAC
ACGATCCTCTACGCCAAGCAGGGCGCAACGTTCAGCACGTGCTGCGAGTACCCGGCCGGGTACGTGGATCCGTACCCGTCGTTCTGGCGGGCCATGCACA
CGCTCGCGACGCGCACGCTTGCCATTGTCGAGACGGTGCAGCGTGCCACTGCCCAAGTACGTGGCCCCACGAACCGAGACCGAGAGACCAAGATCCAGTG
GATGGCACGGCCATGGCTTACTAGCGTCATCCACGTCACGCAAATGCTGCTTGACATCTCGACGGCGCAGTCCAAGCAGCAAGAGCTCAGTGCCGAACAG
GTCGAGTTTCTCAAGTGCGTCATGGAAGAGAGCCACGGGAGCGGCGCCTCGCGGTTCCTCGGGTGGTACCCGAGTCTATTCTACACCAAGCGTGAGGACT
CGGCCAAGCGCGATGTGCTCGTGGCCGACGTGCACACGGACACACCATCCGTCGAGCACGGCGACGAAGGCGGCGTGCTCCACATGGGAGTGGGTGACGT
AAACCTCGCCATGGNNNNNNNNNNAGCACGGCGACGACGGCGGCGTGCTCCACATGGGTGTCGGTGACGTAAACCTCGCCATGGTCGTCGTGGACGACGC
GCTGTATGCAGGACCAGTGTTTAGCCACTATGAGCTGATCACGCCCATCAACGAGCGGCTCACGGATGCCGAGTTCAGCAAGCGACTGCCGTCGCTGCGG
GCCCCGCAGTGGGNNNNNNNNNNCGGACCGGTGTTTAGCCACTACGAGCTGATCACGCCCATCAACCAGCGGCTCACGGACGCCGAGTTCAGCCAGCGAC
TGCCATCGCTGCGGGCCCCGCAGTGGGCGCGCGAGTCGTTTCTCGTGACCAAGTGATTGTGCTGAATACAGCGAGAGAGAGAGAGAGAGAGAGAGATGTA
ACGTACACATTGGCCTGAACGTGCATTACGTGTGAAGTCGCCTTGTGGGAGCATTGGCCATGGCTCGACGAGATGAGGAGCCGCATGATGACTTTTGACG
GCAATGACACTTCGCCCCCCGTACAAGTTCACTGCGATGCTACAGGAGATGAGGTGCGAGGACTCAAACTAAAGCTTCCGGGACGTCGCCGAGGCTCAGG
AACCACATGCAGATACTTGGTCTTGGGGTTGGCGAGAGAGACACCCTACCTGCTGATGGTATCAGAGAGCATAATCTCCAAGCGACAAAGAGCTTGCT