Description :
From Genome Similarity Track
Location :
scaffold_383:22383- 25212
Transcript NameFunction/comments
Pl_105402hypothetical protein PHYSODRAFT_408591
Pl_105403NA
Pl_105404NA

Sequence
2829 bases(100 bases per row)
ATCTGGCAGCTTGAACTTGGCAACGACCCACCAGCAAGTGTAGCCCCATTGGAAACTAGACTCGAGGAAGGTGCACGTGGTGTAAAAAGCAAAACGCGTC
GCTACCCTCCTGTGGTGCGCAAATTCATTCGCGAGTTTAATACCAAGTTAGTTAAACTAGGTTGGGTATTTGAAAACCTTAACAGTCGCTAGGCCAGCCT
AATGCCACCAGTGCGCAAGCTTGGTAATACTTCCGACAAATATCGTCAAACCTGTGACAATAGAATCGTAAATGATCTAGTAGAAGCGCTCATTAGTACG
ATGCCTCATATGACCACACTTATAGAGCAAACTAGGGGTATATCCCATTTCGATTTGCCCGATCTATTGAAGGCTTTCGGCAATTGTCATTTGATGGGCT
TAGCCAAGGGCTGATATCCTACATCACGGACTCAAAAATATATACTCCTCATCGGGTCCCCAAGGGTGCTACGACGCTGTTGTTCACTTTCAGCAGACCA
TGGATCACTGCTTTGATTTGCTCTTGTAGAAGTTCCTCATTATTTGGATTAACGACATCCTGCATTTTGCGGACGATATCAACATTTACCTAGCGAAGTT
AGAGCAATTATCTGACTGCTAAGCATAGACTTAAACTCGGTGCAAAAAATAGTCTGTACCGGCAAAGTGCAAAATGGTGTGGGCGTAAAAATAAGTGGTG
ACGGTGTATCACACCTCCTAGCACACATTAACACACTACAGTCGACGCCCGCAGCCAACTGGAAGCGGGAGTCCATAGCCGACTGTGCCCGCGCTGTAGA
CCCCCTCCAGCAACGATTAGATTCTGCACTACAGAACAGGAAGCGCACAAACCTAATCGCCGATGGCATATTCATCACTTTGAGCGATGCGGAACGACCA
TCATTCGAAAATGTTAAAGAACTCGTGGCCACATCAGGCACGCTGGCGCTGCCAATGACGACGCAACCATTGTAGCATGCTCTGATGCATCGGATAGTGA
TTGGTCAGTCATTGTGAGCCAAATTTCGGACTATGACGCACTCGTTCCAATTGACGCGCTGTAACACAACCTGCTCACGTGTCTTAGCGGCACGTCAAAG
GGTTCCCAGCTAAACTGGACTGTGATTGAGAAAGAGGCATATCCCACTGTAGTAGCATGTGAAAAACTAAACTACCTCCTACTTCGACCTCGGCCGTTCC
GGTTATTCTGTGATCATCGCAACCTCCTTCATGTATTCTCTCCCCACGCGAGTATCAAGAAACATATTAGAGGCAAATTGCTGCGGTGAGCATTGAAGTT
ATTGCCTTATCGTTATATCATCGAGCATGTCGACAGAGTAGCGAATGTCTGGGCGGATATGTTGTCCAGGTGGGCCGGACAGCCTACTACCAAGGTCACT
CTAAAGCGGTTTACTTGTAAAACATCCAAGCAGTAGCGACCTGCGTCGCAGACACGTACGAGGTAGGTTCCCCAACCTTTAGATAGCATTCGTCTGACCC
TCCCTGGTCGAGATCATTGCGGTCAAACACCAACCACTGGCGGGAGCCAAACCAAATAGCGACCGTGTTCTACAGGTTAACGAGAGGATCTGGATACCTC
GTGACTGCGTAAATCTCATCCAGCGGTTGTGTATCACTGCGCACTGCGGTGCCCAAGGTCACGGCGGGTAGCAGGCTATGGTGAACCACCTCCGCCAGAT
GTTCCACATCCCGAACATCCAGATCGTAGTGCAAGCATTTGTGTCGAACTGTATACTCTGTCCACATGTGAAAGGTGCTGAACGGTACACAGGCTGTGGA
GCGAAACCATCGAGTGCAGTGACAGAAACGGTGTATTGCATTGGGATTTTCTGTCTATGTGCAAGTCTTTGGTACTAGTAAATAGCTGCTAGTGCTGAAA
GGCCATGCCACGCATAACCGCGAACTAGTAGTGTGTGATACGGTGGACAGTGCCGTAGCCATAGCAGCCATTCTAGACTGGCACAGCCGATTCGGTGTCC
CGCCAGTATGGATCAGCGATAACGGTAGCCACTTCAAAAATGAAGCTGTTGCCGAGCTTTCAAAGAGACTAAAACGTCAACAAACATTCACATTGGCGTA
CAGTCCGTGGATCAACGGCTCGGTTGAGCGCGTCAACCGCGATATTCTCCAGGTAATTCGTGCTATGATACTAGAGAACAAAATCTCTACACAGGACTGG
GTCTACCTAGTACCCCTTGTGCAATCTAGTCTGAACCATACTGCAGACCGTCGCTCGACAAGCGAGCCCCAGTATAGTTTTCACTAACCTACCATGTCCC
TCGCCTCTAGGTGAGGTCTACAAAGCTAGCACCAATATTCCAGTCCAGCTACCGAGCTCCTTGACAGCCATCTCTCAACTCTTAGCCGCACTACGTGACA
GCCTACGTGCGATGCATCAGCCTATAGTTAATAAGAGGCTAAAACAGCGCCTGCTCAACAAAAAGCAGGAGCGAGGAGAGAACACCGTCAACTTTGACTT
GGACGACCACGTACTGAGCTCATGCATTGCGTTGAGGAGAAGAAGGGCAACAAACTCCTTGTCACATGGCAAGCACTGGACATAGCGGTCCGAGCGGACG
CACACTCCTTCCGGGTACACCATCTGGTCGCCGGAGAGGAGCTAGATGTCCACTCGTCTAGACTAAAGTTCTGTGCAGACGCCGAGGAAATCCTCGAACA
TGTGGCTTCCCAAGACTTCATTTTGTCCATCCATGAGCTTAAGAAGCATTATTGGATCTCTACCATCAATGACTGTGAGATATTAGGTAGCTGGGAAGGT
CTGGAGTCCATAGATGATTCATGGGAACC