Description :
From Genome Similarity Track
Location :
Scaffold_4:2238- 7554
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_4-snap-gene-0.29CofD
Pytap_DAOMBR444maker-pag1_scaffold_4-snap-gene-0.54SET binding factor 2

Sequence
5316 bases(100 bases per row)
CGTCGGATCGATGCCGTGGTGATGATCCTGGAAGATGTGCTCTACGACCACACCAACATGCTCGCCCACTTCGCCATTGAGCGTGCTATTCAGCAACTGA
TCAAGGAGCGCGCGTTCCCCAACACGGTCGCTGCTTACGAGGCACTGCAGTCGTTCCGCCATGCATTTGGCTACCGCAAACGCTTCCCGCGCTTCGTCGA
CAGCCTCATCGCACAAGAGCGACTGAGCCCTGTGGCCGCGCAGAACGTCATCCGCGCCTACTACGAGAGTCAGATCACCGAGGCACGCACAATCCGtCCG
TTTGGTAAAGCCCGGGATACGCTACAGAAGCTGCGAGATGTCTACGGcTACCGCCTTGGTCTCGTATGTGTTGGCAAAGATGATGTACAGCTCGAGCGAT
TGCGGACGCTGGAGCTGCAGGACTTCTTCAGCGAGATCGTATTTGTGCCTAGCAACCCGAGCGTGGCGCAGCTGTCACACGCCATGAAGGAAGTCGGCCG
ACGACTGATGCTGCAGCCGTCGTCGATTCTGTTCGTCGGTCGGAAGGTTTTCTACGAGATCAAAGCTGCCAATAAGGTCGGACTCGTCACTGTGCGGATG
GTGAGTGGGCTCGCAAGAGAGGACCGTGTGGTAAACAACAAGCAGGGGTGCAGCATACTTATCTGTATTTGTGGGGTGATAGTTGCACGGCAAATACTCG
ACCGTCATGCCGATCGAAGAGCTAGAACAACCCGATTTCCAGGTATGCAAGTGACATCGAGCTGTTGAGATGAGTGGATTGTGATGATTTTATTCTTCAC
TTCTAGATCGGATCCATAGACCAGCTCGTGGCTATTGTACGTCTCGCTGACCAGCAGATGATCAAACCCAAGATCGTTGCGCTTGGTGGAGGCACTGGCC
TGGCGGTGCTGCTCAAGGAACTTCGTCATTATCCTGCTGACCTCACCGCCATTGTCACGGTCTTCGACTCGGGTCGTCATTCAGGGgCACTTCGGAAGTA
TCTAGGGATTCTCCCGCCTGGCGACATCCGCAACTGTCTGGTTGCTCTCTCCGACTCTGGTGAGTGCATTCAGCTGATGTTGTTTGATGTTAGCTATCTG
ACTTCAGATGCCTTAGATGAAGTCATGAACAAGCTGATGAATTACCGTTTCCAGGAAAATTTCATGGAAGGCTGCAGCTTGGGCAATCTGCTCCTCGCCG
CGTTGACAGATATTCAGGGCGGGTTCGACAAGGCGATCACGTCCATTTCCGACATTCTTAATATCCACGGAAACGTTCTTCCTGCTACTCTTGATAGCAC
AGAACTATGTGCAGAGCTCGAAGACGGATCAGTCGTGGTGTCGGAAGTTAACGTGCGAAGCCCGACcGTTGAACAACCAGATGGGAGCCGAGTACGCAAA
GCTCCAATCAAGCGTGTCTTTCTTGAAAACGAGAACGTCAATGCCTTCTTGCCAGCAGTTCGCGCAATCGAAAATGCCGACATTATTGTCATCAgTCCCG
GGGGATTTTATACCTCAATTATCTCCACGTTACTTGTTCCGGGCATCAGAGATGCAATCAGTCGAAGCGCTGGTGCAACCGTTTACATCAGTAATGTTGC
AACTCAGTGTGGCCAGACGGACGGCATGACTTTGTCGGACACGATTGATGTTCTGAACAAATATCTCGGTGGAAACAATGCCATCGACTACGTGATCGCG
AATAATGGCACCCCGCCTCCTGAAGTGATGGAGTCATACATGTCTCGTGGTGAAACaCTGCTCTTTCCAACTGATGATATGCTGCAAAAGCTGCAGCCTA
TTGTCTTGCAAGGCAAGaCATTCGAAGATGTAGAAGACGGAAAAGCGTTCTCGATGAAGAAGGAATGGGATAAAATGCCCATGATCAAGCACTGTGGGAA
GACGGTGGCGGGCATGTTGTACCGAATCATCGAGCAAGAATTAGAgCGGATGCGTGAGAAGATGATGCAAGGTGgTCATTTCCGCCATCAGcTCCCTGCT
TCCAAAGAACTTCGCCCGACCACGGCAAATCATCCGCCAATGCAAACGCGGAAGAAACGCTCTTCTCTGCAGAACCGGCGCAGCGAGAGCTTAGAAAGCG
TTAGTGAACCACCAAATCTCGCCGAAAAaGAAGACCAGTCGCAACGGACTCGACGTACAGCAGCGTTAGGATGCGTACTTTTGGCAGTTCTGTGTGTCTC
TTCTCTGTGGAGATCTCGTCGTTAACAATTTCATGCGTTTCGCTCGGATTCGTCAGAATCACTCGATGGCTCTTCAAACCCGTTGAATGAAACCACATAT
TCACTGAATGCTTGTGTCGCCGCAAATAGAGTTCGGAACTCGCGCGCTTCTGGAGCTGATGCAGCGAGGTAACTCGCCTCATCGAAAAaCaCTGTCTTTT
tCTTCGAGAACTCGTCTGTCCACGTGTATCGGTGGTAACCAAACTCACCGATAACCTTGTGCACAGCCTGGTAAAACAGACGACGGACAGCCATATCTGG
GAACACATATGGATTTGTTGGGTAGCGATGGGCGAACACGTGATCACAGCGGTTTACGTTCGGCTTCAAGCATTCGCAGAGCCCTTCACGCAGTGAAAAT
AGCACAGACGCTGGAAGTGCGGATGGAATGTCACCAAGTACGAAGCAGCCCTTGTCCAAGTCGACAACAAGAACATCATCACTGATTAGATCGTTTCGAG
TGGCTTCCTCAAGCGAATCTTTtGAGATACCGAAAATGAATGGAGTCGGGCATTCAAGGTATTGCAGCATGCGTCGTGGCAACAACGGAAGATAGACGTG
TGGCCACAGAAGTGGAAATATTAGAGCACGAAAAGCTTCACAAACACGCATCAATATGGACAGATGCTTCGAGACGAACAGAACTCGACTTTCGAGCAAA
ACAGCCGCAAATACTTGAAGAACAGTGCCCACATCTAGAGTGTCGAACAAAAGACGGATTGAGTGATCTAACCGAGGAAGACTGGCCACTGACGACGTGC
CCGGGAGGGGCGACGAGGGTGAAGGCTCGAAAGATACAGAGCGAGAAAGCTTTGAAACAAGTTTCTTGTCCAGCTGAAAGGCATTACCCTGCGAAGGTGA
GGGGGTTGCAGATTTTTGCCGCATGATAGACTCCACTTCGATCAAGAACTCGTAGCCTTCAGCTAGTCTCTCACGAAGCAAATCAACGAGAGGAAACTTA
GACAAAATACACATTCCATACGGAACCCAACGTAAgCCGGCTCCAGTACTGATGTCGAGGCGAACCTTATCGAAAAATGTTGGCGGCAGAGGTGGCGCTG
GCTTGTACATGACAACACATGCAGCGTATAGTTCGTTAGACGATGAGCTATCCCCcATCTTAAAATTAAaGGCAACTGGAGATGGGCACGTCGATGCGTG
CACGACAACGTTCTCGAGATCTGAACACCACGGGAgAATAAAACTCTCGATAGAGCGGTCCACAGCGATTGGGTtCGgCTCGTGTGgCAAAGGAaGCTGC
ACGACTCGCAGTCCAGCAGTACCAGCAGCGgcTTGGtCAGCATCACaCACGGCATCAAATGAAaGAaTACCGCAAATCGCATCGTATCCAcGTCCAGTTT
CGAGCACATCGAGTGATCGCTTCCGCAACGTTTCTCTTGAAGCTTCTTCTGGCCAGTGATGAACACGCAGACCATAGCTGAGCAGCAGACCAGAAAGCCT
CCTCAAGTCGTCCATTGACTCATCATCTTCGGGGCTCTTTGGATAAAGGGAGAACTCGGAGTACGCACGGCTAATGAGGAAGCGGTGGTACAATTCAATG
TGGATAAGATTAAACTTGGCAAAAATCGCGTCTTGCTCATGCTGCAGCCGTGCAAATGAGGCCGATACCGACTTCTCGAGCTTGCGCATCTCCTTGTCGC
CGGgATAGTACTTTTCACAAATATATCGAATCAGTTTCTTGCACTGGCGCGAAGCGACTTCCTTtGTTtCTTTTCGTCGCCCCtGGGTTTTGAGcACCCc
GACGTACGCGCGATAAGCAGGTTTGAATTCATACTCAACGTCcAACCAGAATGCGATCTCTCGGTGATAGTTGTGCGGAAACAAGAAGATGAGAAAGAAG
TTGGCGAAGCGCTGATTCATCAAAATGTCTTCAAGGCAGATCACTTCTCGCTCCACAGACTTCTGCATCTCACTATACAGATCGGTTCTTCTAAATTCAG
GAAACCTCTCCATCAGATCTCGCTTGACTCTTGTAACCAAGAAGTCAAATGTTCTCAAGGCATCTTCGCCTCCTGTGGCAATATCCCGCTTTATACGATG
GAGCATTTCCGAATCGACGAGGTTAGTTCCGATGTGAAATTGAGCACCTTTCGCCAGGTACTTGGTCGCAATTTTGACACCGTACGTTCTAAGCATAAGG
ATGTCATCCTTGCTGAACATCGCGCTCGTGCTTGTATTATGCTTTGACACTCCAGGCGGTCCGTACCCATTGCTTCGCTCGTGATAGTTGTTCCGTAATG
TGTACCAAAACTGGCgaTATTCTTGAAAAGAGCACAGAAAGAAGAGCTTACTTTGATCCGAAGGGTCCTGTAGCCATGCCGCATAGTATCTCATCATCCT
TGGGTTCGTGACAACTTCTTCCAAGGAAAGTAGCCCTGCTAAaTCTCGATCACCACcATTCGCTTGACCATTCAGATACTCGTGCATCCAACGGTTCCAC
TTCTGTAATTTCGCTGCTCCAGGTGCAcTTCCCAATACGTTGTTTGTCGGAAGACTCACATTGTCAATTGGCTGCTGCTGGGATAaGATTGCTCTCTGTT
TCACTGCCCAcTCCTGTGTTGCAGCGGAGACGAAAGGCTGGTGTGGCAGCTGTTGTTGAGACTGCACTGCTGAGTTCTTTGCGCTACCGCCCATTCCCGA
AAAGAGGAAGTTCCGTGCCCGTAACTTGACATGCTGAGCCCATCGTGACCGAGCCGCTTCCATCTTGAGGTCTTGCTCCTCTTCCTTGATACTGGTCATC
GGCATGGGCTTCACGTGGACACCCGTCTGGGTGTTGAGGACCTCTGATATCTCATGCATTGACATCTCTCGTTCAGGCTCAAAGAGCTCCGACTCGCGAA
GCATTTGCTCCGAAATAGTGCTACGTCGAAAGGTATTGCGACTAGAAAAACTGGAGGTCAACAAGTCGGAGAAGCGAGCAGAGGACATCATGAAGTCGTC
TGTGTGGATCGCCGTGCCCCTTGAGCTCGCCATGCTCTCGCGGATCACTTCCTCTGCTGAGATCATACTGTCTGGAGGCAGCGGAGGGCTCGTGTCGATC
ATCGAGGCTACAACAA