Description :
From Genome Similarity Track
Location :
Scaffold_1006:2238- 4650
Transcript NameFunction/comments
Phyta_totarag11725hypothetical protein
Phyta_totarag11726hypothetical protein

Sequence
2412 bases(100 bases per row)
GATCCGCGGATCGACAGAGGTTTGTGAGGAGCTCTACGGACGGAACAGAGGAGAGTCCGGCGACGGACTCGGAAGAGAAACCTCAACCTCCTCCCTAGGT
CCCTTCGATGACCCCCGCAGATATCGATGCGAATCGCGATCCGCCGGATGAAGGACCACCAGCGAAAGCTGGAGGTACATCATCCAACCAACCACTTGGC
TCAAGAtcgagcgccaagaagaagtctgcAAGAGTGAAGCCCATGCGGAAGAAGATGAGGGCTCCGGACTCCGACGTCGAAGATCGCTTCGAGCCTGGAc
cgaggagcagctggaagctgcatattacaagaagaacttgcATGCTTTCTTGATCCAGAATCCAGTGGTGCTGGTTCTCCGGCCGAAGATACTCGGCGAT
ATCAAGGGTCCCGGGTCGGAACCGGTCGCTGGGTTGAGCAAGCTGGATACGGTGAAGGCGttgctccaactgctgaAGGAGTCCGGGATCGTCACTGGTG
CGTTCGAAGCTGACAACGGCTTCGAACTGAAGCTTGGTGCGATCGAGCATGCGCTCAAGACCCTCTTCGAGAGGCTGAAGCCCCTGGTTGGCATGACCAG
CCAGCCCACCAAGGAAGCTGCGAGATCGCAAGCGACCCACACACACTCCGGACGCTCAGACTGGCACGTCGTCGCACTACGAGTCGGTGATCCGCCATAA
ATGGCACTGGGACCACCCGGCTTCGCTATGCTGCGAGGCCGAGCTGACCGAGCTGAGCGCGAAGCAGTAGCTTCTGCCCAAGAGACGAAACTCGCGGCAG
TGATCCCGACGCGCCACTCACCGGAGAAGTTGGAGCCGTACTTTCAAGCTGCGATGGGACGCTTCGTGAAGGAACAACAGTCCACTCCTCGCCCGTGTGT
CGCAAGACCAACCGGAGATCAAGACGCGGAGATGGAGTCGGCTGGATCGCCAGATCCCCACTCCTCACCGCTGGAATATGATCCCGACGATCATGATCTT
ACCACGACTGATCGCGCACCAGTGGCCACGACAGCGACTTCACAGACAGGAAGATTGACAACCGCCCCACGCATCGGTGTGTCGGCGATATCGGAGCTGA
AGGGATTCACTGGAaaggaggacgacgaagatcgaGCCCGATCCTGAATCGGCAAAGTGAAATCAGCGCTCatccgagatcaagcgccTGATGATGAGAA
GTGCCTGGTCTTCGGCGATCTTCTAACGGGGCCGGCGCGGATCTGGTACCATCAACTGAGCCGCACGACTCGCAGCACCTGGAAGGATCTGCCCTTGAGC
TTTCAGACGCAATACTGTGGCCATGGTGTATCTGTCACGAGACAGTACTACCATGCGCGGAAGCGATCGGACGAGTCACCGCTGGAATATCTGCATCGTC
TCAATGTAGCTGGGCTCCGTGCACGTCTCCAAGTAAAGGATGATCTTCAGAGACTCGACGTGAATATGACGAGCATTCATCGAGACGTTGGATGACCGTG
ACCTTGCCGATCACCTCGCCCTGTTGCGAAAACCAGATGCTGATACCCTGGAGAAGACACTTCGAGCTCGACAGCGCGCAAAGGCGCGTCAGAGCAAGGC
CGTCTATGGATCGATCAAGCCTCGGAAGAGAGCACCGGCCGCAGCCACACCGTCAGCCGCCACGCGAGCAGTTCGCGCGATCCACGTGGCCGGCGCCAGC
AGTGAGTCGGAAGCGGAGTCGAGTGAATCGGACGGTGAAGCGGGATTGCGCAGAGTGTACCTGGCAACAGCCGGAAACATGTCGAACCGCAAGATCGTGG
CCCACCGGATTAAGATCGCGACCGTACAGGTCACTCGGCCTGACCACCAGCAAGGTCGCCACTCCAGATCGACTGACGTGGGGACGCAGTTCAATCACTG
CTCACACTGTGGGTCGCGCAAGCATACCGATCTTGGATACTGGGGACGCTTGACCTGCGAGAAATGTAGCCGAAAGGGACACCCTTCCGATCGGTGCTTC
TTCGTGTGTAAGGCTTGCGGCGAGATCCACGACGCCAGCCAGTGCCTGATGGAGGAGTTTTACAACTTGATCCGTCAGCGGTTTAACCCCATCAAGCACG
CAGGCATGCTGccggagacggcggagaagatGTTAAACTAGGACGCTCGCTGGTTTTGAACCCGGCACGAGACGAGCGTTCTAGATACTGGGTCTATGCA
TACGTCGAGAAACAATATGAGGTGGTGGTTATCAAGCTGATGAATCCGATCGACAATACATGTGATCTTCATGGACACCTACGGCTGCTGTGTCAAGATT
GCACAAGATCGATGAGTACTCAAGGTCAAGTGTGACAATGGCCTTGGACATTTCGCCAGGAGAATCGCGTGGCTACTGGAAGTACCACGTGCCtgacaag
aagttcaagcag