Description :
From Genome Similarity Track
Location :
Scaffold_30:223771- 228847
Sequence
5076 bases(100 bases per row)
GCTCTGTGTCGGACCCGCAGCCGGAGCACTCGGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCTACTCTTGCTTGA
CCGGAATGGAGAAGTCTACTTTCCACGTGGAGCGGATCCTCTAGGAGCAACGGCGTCACGGTAAGCGGTAGCTCCTCGTGAAGTGGAAGGGTTACGCTCA
CTCTGAGAACTCGTGGGAGCCGATCGAACAAGCACTGATTGACTTCCTGAATGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTC
AGGCGCTTCTCAACCGAACGGGGTACGGATGCTGACGTCACTCCGTAGCCGCGCTCATCGTGAGCCCTAGAAGCCGCGTGCTTCAGGATCTACCTTGCCA
GCTCGCGCTTCCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATACGGGACAGCAGCTGATCTTCATGGAGTTTTCGTAACTCCGT
GGGTGAGTACTTAAGAGTATCCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCTCGTGGGACAGTTCTCGCGCATAAGACAGGGGTATCCCCAAAG
AGGATAGAGACCACACCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGAGGGATACGGTGTGGCGCGAGAAAGCACACACCGAGCAGCCTC
CATGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCACGTTCGTAGATCCCCCTAGAAGTGTGGCCGCCCACAAGGCCATGAGGAGCGACGAGAACC
TCTAAGAAGAGGTCAGCCTCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCAC
GCACACGCTGGGCAGCTTGTAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAGAGATAGCACCCTCCTCCTCCTCCTCTTCATC
CGAGGAGTCGAAGATGCCCCGATGGGAGTGCCGAGTCTCCTTCTTCTGGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCG
GCTTTAGAGGCCTTAGCACGCGCAGGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCT
TGACGACCGGACTCTCAGAGCCCACAAACGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACTGGGCAC
TGGGCTGTGCCTATCCCGCAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTTGGTTAGAACATAAGC
AGCGTACGTAGGTGGTGGCCAACATGCCACCAGCCGAAGACATGCAGAGGTGAAAGACGCTGAATGCTTTGACGATTGAAGATTGTGCTGCCGGCGACTG
GGGATGCTCTCTCTTAGTGTTGTCAGTATTTGATAAAGGCGTGCGGTATGCGCCGTATCTATGGGTGGTAGCACAGGTGGTGACGGTATGTGCGGGGTGG
TCGTGAGTTTGGTTTGGTTGATTTGATTTGAATCTGATGAGGGTGGGAGTGGATATCTATGTTTTTGTTGCATAACGATGACAGCTTGGCCGAGTGATTA
AGGCGTTAGCCTGCTAAGTTAATGGGGCGACCCGCGTGAGTTCGAATCTCACAGCTGTCGTTTTCCTTTACCTCAGCAGACTCGCGGTAGCAAAAGCGGC
TATTTCCTGGCCTGCTGACCAGGTAGATAGATACCTCTGCTTGTTGCTGGATAGTGTTCCCGACCAACACACGTGCCAAGCGTGTGAAGACATNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGA
GGAAGGTATGCCGGGTTACGTATCCCTTAAGTGTAACCTTGGTTTCATGAAGTATGACACTTCACAATTTAGTACAAGTGTACCAAGGTCGTTCAAAGCT
CAACCATGGTCAAAACGACATTGCATTTCTATAGGTGACTTATAGTTTGTATTAGGCCCAAGCTTTATCTACCTATGAATATACTCAGTTTACATTCTAC
CTTAATTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCG
CAAGGTGACCCCGTAACAGTATACGTTGTTGCCAAAGTCAGGCGTGACATCATCGCTATGCTTGTAATCAACGGAACCGCCAACTACGTGCATCTTTGAC
TTGATCCAATCACTTGGTGATAAAACTCGTGAATCCTCCAGCTTGGGCTGATCGTATTTATCGACAGATTTCATGTGCTAAATACAATGCTCACTATAAA
TTTCTTCAATAGCCTTGGTCATCGTTGGTTCAGCAACTGCTGGCTGATACTTTGCGTGGTGTCGGCACCAATCGCCTTTTGAGCCGCACTGTTGGCTCGC
CTTTGGGTGGTTTTCTGGGAAGATGTACTTACACATTGTTATTTCTATATATTTATTTTTTATCGCTCAAGATGAACTCACTATTAATTAGTTTCTATAT
ATTGAGGAATATATTTGTCAGAAATAAAAATAATTATTTTGGAGTGATCGGATTGGTTAAAAATGAGCCACATGTCGCGTGAATGTGTGCCGCTTTTCAG
TCGAGAACTGTCTAAGAGAAAGCACAGGAGCATGACAGAGGAGACGGATGTGAAGCTGCGCTGCGGTGTGTACGGCGATGGGAGCGTCTTCTCCGTCGAG
ATCAAGCGCAATGCAGATGTGGAGGCGCTACAAAAAGCTATATTCGCGGAGAAACGATACAGCGAGCGTTATAAGTTTGCCGCAAGCGACTTGACGCTCT
ACTTGGCGCGAAAGGAAGGGGAAACCGTTTGGTTGGCGGACGACCGCAACACGGAAAGCTTCTTGCAAGGTGGCATCAGCACTGGTTATAACAAGATGCG
TCCGTCGTGGAAGCTCAACAAAACGGAGTTGTTTGGGCCGAGTTTCACGCCGGGAGATGAAGAGATTCACGTGCTAGTGGAACTGCCACAATTGTCGGAA
GTTGAGCTGCCTCGAGATCGTCAACTTGCTGTGGGCGACGTTCATATCCCGATCACGCAAAGTATGTCGTTGAATCCGCCAGCACTGGTCGCATTTAGGA
AAGCATTTCTGAACGACAGTACCGACGTGAAAGCTGACGCATTGGTCGAGTTACCCCGAGACACGTATCTTCTTGGTGATTCGACACTCGGCTCTCGTAT
CTACATTCGTCATTGCTACCCTACGCTATGGGAGCTTTGTCACGAGAGGTCCATGATGAAAAGAAGAACACACCGCATCTCGTGATCCTCGGCAACCCGG
GAATCGGCAAGACGTTTTTCGGCTTTGTGATCGTGCTTCATCTTGTCCATACTGATGCAACGGTGGTATATGAGAGTGGTGGCCTCAAGAAGCGCTTTTT
ATTTGCTCACAACGTGGTGGCTCAAGGATCTCAGGAAGATTTTGTGCACATTCTCGACCAGCCGACTACATACTACATCGTGGATGCCGTCAAGCCTGCG
TATTACCCAGCGAAGACGATTCTTTTGACGTCGCCGCGCCGCTCCATCTGGTACGAGTTCAACAAGACCAATTGCCAGTCCTGCTACGTGCCAGTGTGGT
CTTTGAAGGAGATTCTACAATGTCGTAAGCTGATGTACTCGGATACACCTATGGACGTCGTGCAGGAGTGCTTTCGTCGATGGGGTGGTATTGCTCGCTA
TGTCTTGCGATTTTCACAAGTTGGTGACCAGCAGGTGTTGCTTGAAAAAGCAATGAACATTGTTGATCTCGACTGGTTGGTGAAAGCCTGTAGTCAACTT
GATGCGAACGACGCTCAAGTGTCGCATCGATTGCTGCACTATCGCGTCAGCAAAGCTTTTGACAGCGAGTACTTCGTTTTTGCATCGCAATATGTTCAGC
AAGCGGTGTACAATCGGCTGTACAAGAGGAATAAGCGGAAGCTGCTAGAGTTCATTGCTGCCTCGGATGGATTTGGTGCTCTTGCTGTGCTTCGTGGCCA
CTTGTTCGAAGGGCATGTGCATTCGGTACTGCCGCGAGGTGGAACGTTTCGAGTTCGACGTTTGGTCGAAAACAACGAGGCGTACGATGATGATGATGAC
CCTATGGGAGATGAATGGGACGGCGATGACGAGGATGGTGATGATGGCATGAATGCAGATGATGCCGTTGCGATGGAAGAATCCAATGCTGTGGCGTTGG
TCGACGGTGGCGCCGCACCTGTTATTTCTTTTGAGAGATTCGAGAAAGTTGTCGTTTTCAATGATGACAGTGAAATTGAAGCTGCTACTAACACGAGTTA
CCTACAGCCAGCGGCGAAGAATTACCAGTCGGTCGATGCGATCATCAAGCCGGATATTTTGTTGCAGGTGACAGGTGCACACAAACACCCCTGCAAGCAA
AAAGGTCTCCACGATGTGTTGAAGCTTCTGGGAAATCCTGCAGCACCGCGGCTGTTCTTCGTGCTTCCGCCTGACAGATTCACCGATTTCAAATATCAAA
AGTATCTGGACTCAAAACGCAAGAGGATGATGGCGCCAAGCTATGAGAACGTGTGCAAGATACAGCAGTTTGCGATGGAAGTCAAACTTGAATCGGAGTA
GGTGTGCAGTTTCGAGGTTCCAAAAACCGCGTTCCGAACCGGTTCCAAAATGATGCCGTACTTCTTTGGTCCAGAAAAGAATTAACAACGAGGTTTTTCT
TTAAAAAGCCTCGCATGTTTGATTGGTCAATGTCCACTCTGAGATGGGTTCGATTGGTTAAAATGAGCTCATATGAGGATTTGTATGCACGCGGGTTGAG
AGTAATTGACACAAAAATGGATTGAATTGCTTTTAGTGATATACCACTAGATTAAGCTTTATTTGCTTTTTTCTAA