Description :
From Genome Similarity Track
Location :
Scaffold_450:22372- 24295
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_450-snap-gene-0.24Tetratricopeptide TPR_2
Pytve_DAOMBR484maker-pve_contig_450-snap-gene-0.17Dynein light chain/pantothenate kinase

Sequence
1923 bases(100 bases per row)
TCTGTCGCTGCTGGTCGGCGGTCTGCCGGACACGCCGAGCTTCTCGTGTCGCGCGGATGTGCATGTTCTCTTCCAATTCGCACTCGGCCTCGAGCTGAGC
GAGCCGAACTTGCTTGTAATACTCGGCTTCAACCGCCCGGCGTCGAGTCTTGGCGACGAAGCTTTCGCGGGAGTCTCTAGGTCGAGTAGTGCGTGCCATT
GGCATCACACTCCGCCCTGATGCAGGCGCGGAATTCTCGCTCTGGGCTTGATTGGGATGGATTACCGACGGCTTTGGTGCCACTGGTTGTGCTTGCTGTG
GTTTGGATCGATGTATTGATGCGTTTTGTGGCTGCAGCGACGCAATCCGCAGCTTGCCGACGATCTTCCCCAACGGCTCAGGCGATTTCGTCGCGGCAGT
AGCACGTAGCCGCTCAATCTCGGCGTAACACTCTTCTATCTCGACTTGCAGTTCCTGGAAGCGGATGAACTTGCTGCGAGTTGAAGATACAGTGTGAATA
TGAGTCACCATGGAGTGTGTTGTTCTCGCTGTCGTCACAGTACCTGCTGTAGCGTAGTTTGTCGAGCTCGCGCTTTCGCTCCTCGGCAAGCGCCTCGGAT
GCCACAGCCTATTAGCGATAGAATCGAATATCAAATGAGCGTTGTGGACCTTCGTCATGTGGACTCACGTGGCTCGTACACGCTGTTGCGCATCCGCGAC
GAGTCGGTCGATCAGCTCTTGCTTGCGCGATTTGGTCAGCTCGGCGTCTTGGGGAGCCCGTAGCAGCTCGAACACCGTTTGCAGCTACACAAGAGGTTGA
TCGGCATACAAAGAGTGAGCTGGACGACATATACTGCAGCTTTCATCACTTGCAGTCACTCGCCTCCTTGTCTTTCTTGCCCAGCGCCTCCTGCAGCTTG
CGCACCGACGTCTTCAGCTGCAAGATCACCGCATCCTGCGGCAAGTCGCCGTATCGATCGCCCCCGTCAGCCAACCGCATCGTTAAGCTAGCAAACTGGC
TGTTTGTACCTTGTCGGCGAGCTCCCGCTTGAGCAGGAGGAGCTCCTGCTTGGCATCTTCCCACTCGCGGCGCTGATTCGCAAGCTACGAGCCGAGTGAT
TCGCACAGTTCAGGATAAGAACGCAGCGAATGCCTTCACCAACGCAGAGCACCGCATCCTACCTCGATATGCTCGAACACGTCGCCGGGGGCAGTCCGGG
CAGCGCCTCCGCGCGAGGCGGTCTTGGCCATGATGGCAATCGTGAGCCAGATCGAGAGAAACTGTATCCATTTAGCCGCTTTATAGAAATACAAACGAAA
GGACTTCAAACCTGTTAGATATAATATTATACGCAAATTTGGTAAAATAATTCAGGTTATTAGCATATTTTGTATCTCCATATCGAATAGACAATGTATA
TTTATAAATGTGTTCTGAAAGTGAAAATGGAAATGATGGCACATGAAGGGTCGCGAGGTCGCTTGTCCAATACGACCAGCAGCGACAGTCGACAAATCCA
AAGAGGCGTTGTCGACTGCTCTCGATCTGGCGAGCTGCGATGGGCGAGGCTCCGAGCTGGCAGCACATGTGGGGAGCCAAAGTCAAGATGCCGTGCGACA
TGGAGGACGACGTACTCGAGGATGCCATCAAGCACGTGACGGCGCGTCTGGCCAAGTTCGACACGGACGAGTGGGAGAAGCACGGACTGGCGGTGAGTGG
CCTCCTCACTGTCGTTGCAAACGAAGTGGGGATGCAGGCAATTTCACCGACTCGAGCTGCAGGTGTGCGAGGAGATCAAGGCGCACATGGACGAGAGCTG
GGAGCCCAACTGGGTGGTCTGCATCGGCCGCAACTTCGGCTCGTACGTGACCCACGTCACACGCAACTTTGTGCTCTTCTACTTCAACGAGAAGGCCATC
ATGGTGTACAAGGCCGGCTAAAG