Description :
From Genome Similarity Track
Location :
Scaffold_296:2237- 9362
Transcript NameFunction/comments
Phyag_g4415conserved hypothetical protein

Sequence
7125 bases(100 bases per row)
GTTGCCTCTACTTCAGCACCTGGCTCTGCAGATTCTTTGCTATCACTTGATGCGAGAACAGTGAACTTGTCTTGAAATAGTGATGTTCCCTCGATCTTAC
TTGACTCAAAGAATTCTGcatgcagccgctgcagtaGATCGGCAGCGGTGAACACAGGAATAAATCGCCAAATAGTCTCAAGTTCATCTGCAATCACGCT
GGCCACGGCAAAAGCCTACAAAAAAACATCGACACTATTAGAGTCTTGATCATAAGCCTCTCAAACTTAATGAAACGTACCGTGAATGTGTCCGCTACTA
GCAGGCCCAGGACAGTGCCTCGAAGACACGCATCGATTGAACCAAGCACCTAGCAACACATAACATACATGTTAGCACCTGAAAAAATTGCACTTAGACA
AGATCGTCCTCACCTTCGTGAACTTGCGGTATTCACGCTTGGTCTCCGTATTGATCGGGCAACAGCGCTTTGCCGTCTCCCAAACCACTTTGGCGTCGGC
ACAGTGTTCCAAAAGCGAAAACGTCCATCGACAAAACTTTGTGACAGCGGTCAATGACtccaactccttctccagagACGGAGGGCAATGATCCGTAAGT
GGATCGAATGGCTCGTTGTTTCCTGCGACGGCGCGGTGCTCATCTTCAACTACAGTCAGGAACGATGCCAAGGTAAATGCGCACGCAGACCACAAGAAAG
GTGCGCCCTTTTCCAGACTACCATGAGGTTCCCACAACGTATCCTCGAAGTACTCCCGCCACAAATCGTGTTCTGAGTCATTTTCGTCATCTTCAAAACC
TCCATCGCGTCCGAGCACCGAGCGGTACCATCCAGGCATTGACAGTTGTTCCTCTACGATAGAGTTCCAGGTAGGAGATTTTTCTTCCTCATCTCCAGAC
AACATTACCCTGGTGCGTTTGTGCTCCTGTTTTTCTTCCATCGCGAGCGAGAGTCGAGGCTCCGACGTTGGGATCAAGAAATTGCTTAACGTTTTGCACA
GCGGGCACAAGAACTGTGTCATTGCTGAATCCGGATCGATCGCTTGAACGCCATCAAATTCCTCGCCACGCATAGCTTTGTCATGCAATGAAGTGATGTA
GCGCTCAAGACATCGAATATGCACAGCATGCTGGCATGTGCGAACGTGCAGGCCGCACGGAGTGAGATAAAGCTTGGCACTTTCGTGATGCCGGCCAAAC
CCGGGCGGGATCCGCTCCAAACGGAAACGTGACGAGACATCATCGTAACCATCGTCATCACTATCGTACATCTCTGTCCCTTGACGGCGTGCGTTGCCCC
CACGGGCTCCAGCTACATCACGACCTCCCAATCTTCGCGGCTCAACGCGATCCCCGCGCAGATCCAAACTGACAGCACCTCGCATATCCATggggaagag
ctgctggtccTCACGTAAGTCTAAAACTCCTTCAAGAACGTCCAACTCCTCATCGGTCTGTAACAGCTCGCCTTCAAGCATCGGGATATTTCCATTCCCA
AAGCGAATGCGGTCATTGCGAGggcgacgagcagcaggcgggCGGGGGCTATTTTGCGCCGTGTTAGCGCGTGTGAGCTGGTCTTCTAATGAACCATCCA
ACCATTCCGGAAAAGAAGTCGCGAAAGCACGCAAAGTGGGTGATGGGGCGTCGGATGAGGTTGACGTCGAGCTTCCACCTGAGCACAATTCCATCTTCTC
GATAACCTCCTTCACGTGACTACGAACCTTTTTACCATCAGAACCGAGCGCTTCATTAGGCTCAGGCCTAAATCCAGGGGCTAGAACGGTGGACTGATGA
ACGTAGGCTGCCATACCCATTTGGCCCTGAGCCGAGCTGTCATGGCAGAGAATGCAATTATAGCACCGTTCATTCTCAACTTTCTGGCGCTTCATTGTAG
TTTTctctggttcttcttctgttgaAGCCTTGCGTTTCCCCAACGACATCTTCGCGTGCTGTTCCGTCGAGGCATCCTTcttttcttcgtcttcttcatc
tgcgagATCGACCATTGCCTGGAAAGCAGCCTGGCGTTTCGCCATTGCAGCCATTGCTCTGTTCCTTGCCTCCAATTTACGCTGTTCCATAGTCATTGGC
GAAGAACTGCTGTCTTGTACAGAGCCACTGGAAGCCGAACGTGACAACTCAGTCTTCTTTTgtttcgccttcgtgtcgTTCGCTAGTTGCTCGAACACCT
TTCTGCACACAGGTGATTCAGCAGTGATCTTCCAGATGAGCCACTCCACAGTTCCAGTCTGTTCGCCATCGAGCAACGTTGTGGCTTGCTTAAGCAGTTG
ACTCAGAAGATGCAACGTTGATAATTTGGAAGTGGCAGCGTTTGTCTTGCTCAAGCGTGTCCAGAAGCGGCGGTCTGCAGTGAGCGATGCCGTGTGAACA
CCATGCACCAGCAAGTGCAAACAAGTCGATACAACCGCGTCCGAGACACTATTCTCTGAAGCCGGTTCGGCTGCCACTCCAGAATGAGTCGACGAAATGA
CTTTCCAAAGAATTACGTGAACAATCGCCACAGTACTTTCACATGTCAGAATTGCTTGAACTGGACGAAGGAAGTCAACGGGAGGTGTGGCAGCCTTCAA
CGGTTCCTTCGGGGGAGCGTCGGGAGTAgttttcttcgccttctgGCGACATGTGTTGCGGTGGTTCGTCCAACGATCACGCGCTAGCTCGTGGGCTTCG
CGGTTCAGGTGAAGGAAGTACGGGTTGTAGTTCTCTAGTAAACCTTCCTTCAATTCATATCGGCCAGGCTCGAGCCCCGACGGCTGTACAAACTCGGACA
CCTTACGAAGAATACTTTCCAATCGCGCGGTAGGAATATCATCTTGTCCTGACGGTAGAATGGCCAGGTCGAACAGTTTGCTGAACGGAAGAGACTTTGC
AcacaactgctgcagcatctcttCGGCCAGGAAATCGTTGTCGTATGTTGCACCAGTAGCGCTAGGAAGACTCGTACCGAGTATGATCACAAGACGCAGG
AATTCCTCGAGCATTTGtagacgttgctgctcgtcaatACCCTGCTCCAGTCCGGCATACCCAAATTGTTTCATCAAATCGTCCGAGCCACTCATGCTGT
CACGCGTCGTCGAAGGTCCATTCGACAGAACGAAATAACTACCAAGCTGGAACCGATCTACCATTCGTGCCAAGAGGACATCTGGACCTGTCATGAggac
accaagctgcagcatgagCGTGTCAGCATCCCGGTAGTGAATGCAATACGGTAGCGCTGAATAGTTGTACAGTTGTGCCAGCATGTTTTCGTCTCCGTTC
CGCCGCCACAAGTTGGAGTGGATTTGGGATGCCATCACCAAACAACGCAGGGGCATTTCCACCAGCTCCCATTGCTGGTCGGCAGGTAATTTGTCAAACC
CAAATACTCGCAAAAGACCGTCAGAAGGAATTGAGTTTCCTAAACCTGACTGGCTAATGCAGATATGCCGCACTGCAGCGGTCAGGAAACGGTGCAATGG
TATGTGCAGAGAAGTCGGCTCAGATGCTACGTTGAAGTCATACGTCAAAATGGTTTTATCGCGACTTCCCGCACCCCGCTTGCTTACCGACGTAAGTTTT
GCCACCGGAACCAGCGCCTTTTTCATGACCTTTTCATTTAGCCAGGCTGACGACGAAACAGTAGCGTCGATAATCGGGCTGAAAATCTCCGCAACCTTCT
CTTCGGGCGCTTCGAACTGCATCGGATTGAAGCCGTTCCAGGAAGTCGCAAAAACCGAATGGACCCGGATACCAAGATTAAACATCGACAACCAACTGTC
TGACTCGTATTCCACGTGGTTCTGGTGAATACCTCGACGACCTTGAGGATCACCACCCTATAGACAAGAAACATAAATCTTAGTACTGTAATCCTAGTAA
TATAATGATAAATCTATAGCTTACCTGCAGAATGCGTAAGCATGACAACCAAATCTTCAAGTTGTCTTCGTTACACACAAGTTCGGTTGACAGCGTGCCG
ATATTAAAAACATACTCCATGTTTTCGATACAGTGCTACAgcacaagcgcaagaaaaGGAAACATTAGTACGATGGTGGGATGCAACCGCACTTTTATCA
GCTCATTCTTTCGTAGAGCCATTCGGTAACAACAAACAGATAAACGTACCTTGTACTTCTGGCTGCTCAGCGCAGGGTGGTCGGCGTTGAGGATACCTTC
TTTATCATCGACCGCAGACAGAAACACCGTTTTTAGAGCACAGAGAAGCTCTCGAATCAACTCTTGGCGCCCCTGGTGTGCAACTGCTTCTTTTTTCGTG
TACTTTTGCACCAGATGGGGTACCGTTAAAAATTGCACGGCAAAATCGAAAATGGATTCGCTGGAGTTGCCCAACCCACGAAGAAACATGCTCGTCATCG
AGGCGTATGAGCGTAGATACGCCTCTAGCATGCTAGCCCGAAATTGGATGTCTACCAAGTGTTCACGCAAAAACGAATGCGATTTCTCCACGGCATTCTT
CCGCAAGGTACAATCATATTGCATTAGCAGCGTGAGAGCTGAAGTAGTCGAGATAGGATCAGAAGCAGTCACTTGCTCAGACGTAAAATACTTGGCCACC
ACAACGTCAAAACTCTTCCGGACAGTGTCATGGCGGCGATACGAGGGACTCAGCGATACGGCCTTGACGAATTCCTCAATAAATATGTTCTTGCAACTAA
CACGGTTTCCGTTAGCTAGGAACCCAGCAGATGCTACAGCAGGCGTGCTAGCTTCAGATCGAAAATCAaagcgctgttgctgggctgcttcttgttcggT
CGCCCAAGTGAAGATATCTTTGTCCCCTGAGGTCAGGCCAACAAGCACCTCCAATGCATGGTTGTGCAGACGGATGCTGTGTTCCTTCACGAATTCTTGA
ATCGTCTTTTCCTTCGTTATAATGCTTGATACGGGTAGAAATCCCCTAAATGTAGGCAACCTCTGTTTTTGAAGTGCTTCAGACACAAGCTCGCTGAGTC
CGTCTGATGTCGTGCTGACAAACTGCAACCACTCCAAAAGTTCAGGCACGCCTTCCATCTGCTTTTCCCACCAAGTCGGCGCGACCGAAATATTTAGCGA
ACGCCGCACCAAATTTCCTACTACCGCCGGACATTGCAACAACGGTTTCTTTGACACAATCACGTCGCCCTGGTTGTCTACTTGGTTGACCGCAATACGC
GCCTGAGGCTTGGACATCCCCAATTCCACATACAAGTGGTTGATCACTTCGTTCAGCGCGTGAACATCATCGTTATGCAATCGAACACCGAAAAGCACTC
CGTCGCTCGTAGTATCGTCAGCACCATTCGCATCTCGCTTCAATTCATTCAGCTGTGTCTGTGTCTGTGCCTGTAACCTGCCACCAGGTCCAATAGTTCT
GGATCCCGGTTCAGCTGTAAACTGTGTCGAAAGTCTTGTCGATCttgtcgacgctgccgccgagCTGTCCCTACCTGTTCTGCTATCAGAAGCATCCGCC
ACATCTGTATCACTCTGAATCGGTAGTAAATTGGGAGGCAAATCTCTCGTAAATAGTTCCAAAGCTTCTGCCAACTCGAATCCATAATCCGTCCCCAGCA
AAACCTGGTAAATAtgctccaccaccgcgtCGATCACCACAGGCGCCGTCAACCCAAGCTGTTTCGGCAATTTATGTTTCTTAACTCCCGCCGCACTCTC
CGACCCTTCCGCCCCTCGATGTCTCGAACAAAACCCGCTCTGCTTCCATGCCTAAAAAAATAACAACAAATAATCACCAAACAACAAATAAGAAATACTA
AAAATAAAAAACTaacaaaaaaacaaaaacaaaatacTCACATGAACATCTCCGCAATCACAGGAACTGCCCGCCGTGGTCCTCTGGAAGTATACGTCGT
GTCCTGCATGGTCGCTATGCGTAAAGCAGTCTTTGCACATGACGCACGTGGTGTCCAACTGGCAGTTGCGGCAGCTGTAGGCGATCTCgtcggccgagaa
gatggcgccgCACACGCGCTTCCTCTCGGTGCGCGGCAGTTTGGCCAGGATCTGCGTGggcgccagcgccttctccttcccGTGGGCGCACAGCGACGTA
AGCAGCACGTTGCAGACGCCTGCGATTGGCTGAGCCGCGCCGCCCAGCGCCAAGTGGCTCTGCAAGGCGAAGCGCACTAGCGCCAAAAAGTCTTCTTCGC
GGCGGCGTgcgagcttctgctgcgacGTGACGCACGTGACGGAGGCGGCGTCAGCAGAAGACACTTTGGCCGCGGTCTTGGGCTTGGCCGACGtcgcctt
ggccttcttgccgcggATCGCTACCATAGTTAATAGTGACGACTGCTTGGGTCTTGCTTCTTCGACGCTTTTTTGCCTTGAGATGAGTATGCAAAGATGC
AATATAGCGATGAACAGGCACCAGTTAGAAGAGGGTACATTCGAACGACATTCAAGCGACATTTTGGAAGGGCGGACTAAGTGCGAGACAGGTTGTGTTT
CGGTGGTCGACGACGCTTCAAGATACAAGGAAGCagcccaagcagaagcttcgagcagaccagtccgaacgtttCTTTCTGTCTTAGGGAATAATATCAA
AGATACACTTTTGGATGGTGACGCTTGGTGTTGAGggtggtggaagctggcCGACGGAGCATGGGCAGCTGTGGCTGAGGATTCGAGGGCGGACAAGAGA
GGACTCGTACGTGGAAACTACATGAAGTTGCAGTAAGTGGGGCATTAAATTGGCCCTCTGGGTTGCGTAGCAATAGCAAAGGTTGTGTGCTCTTGGAACA
GTGTCTGCGTGGCGATGGCGGCTGGACTAAGGAGTTAAACGTGGGGCTGCAGAATTACAAGGATGGAATTATTATTTTCGAGGTCTGGGCGGGCGAGTCA
CGTTCGACGGATTTCTTGCAATTTGTCACGGGATGGACTATGGACTTGGGTCGATGGATCGAGTTTGGGGCAGCAAAGCGGTGGTATGAGATCAAGGATG
CCAGAGTAAaaggacaaggagctgcaggtgaagTTGTAGGCGGACAAGAATATTGTGAAATCGTCATGGAACTACACCAATTGGGAGCGTATTTGGGTGT
TAGCCTAGCTGATGTTGAAAGCCCG