Description :
From Genome Similarity Track
Location :
Scaffold_916:2237- 3397
Transcript NameFunction/comments
g15669.t1XP_009524309.1 hypothetical protein PHYSODRAFT_247331, partial [Phytophthora sojae

Sequence
1160 bases(100 bases per row)
AGTCGGGTCTTCGGCTCAGTGCATCAGCGATGCCGTTCTTCGCTCCGGGCAGATACGAGAAGGTAAGCTGGTACTCCGCGAGAATGTCATACCAGCGAGC
TAGACGACGGTTCGTCATCTTGTGCGTGAACAGACCTTCGCGACTTTTATGATCTGTCTCGACAATCGGAGGCTTGTCCAAGCAGTAGATTCTGAATGCG
GCCAGAGCGTGAACAATAGCAAGTAACTCCTGCTGCTGCGTGGGATAGTTCAGCTCTGCTGACTTCATCTTCCGACTGGTGTACGCGATCGGACGCTCAG
CGCCATCAAAAACCTGGAAGAGAACTCCACCAACAGCAAACTAGCTCGCGTCCGTTCGAAGATGCATAGGCTTGTTGAAGTGGGGGAGGTGCAGTACCGG
TGGATTACACAACCGACGCTTCAACTTCTTGAAGTTCTTCAACTGCACATCGTTGAAGTGGGTCCTCGCGTTGCACTTGTTCTGCTTCTTCAGTAGAGCG
AACATGGTTCCAGTTAGCGAAGCGTACTCCGGGCAGAATCGCTGGACGTATCCCGTCAACCCGAGGAAGCTGTGAAGCTCCTCCTGCGTTCGAGGCACCG
GCCAGTCTTTAATCGTCTAGGCCTTGTCGGGGTCCATCCGAACTCCATCTCGTCCAACGAAGTCACCTAAGCACGGGATCTCTTCAGCACAGAAGACACA
CTTGGCAAGCTTCACGTAAAGCCTGTTGTCGCGCAAAATGTCCAAGGTTTTCCGCAACACTTCAAGGTGTTCTTCAATGCTGCGGGACTTCGTGAAGATG
TAGATGTCATCGTAGAACGATTTCGTGTTCTTCAAGCCACGAAACATCTTCGATGTCAATCAATGCATGGTCGCCGGCGCGTTGCAGACTCCTATGGGTA
GTACCAGGTACTCCCAGAGTCCATTGGGAGCCTGAAACGCTGTGTATTTGATGTCTTCTTCGCGCATGCAAACTTGGTAATACGCGGACATCAGGTCCAT
GGTCGAGAACCAGTAAGCACCCGACATGGTGTCCAGGATGTCTTCCTTTCGTGTCATTGGAATACTCTGGCGCACCGTGTTCGAGTTCAAGTACCGGTAG
TCGTGAACAATTCTCCATCCGACTGGCTTGCGGACACAGAATGTTGGTGCTGCGTGTGGA