Description :
From Genome Similarity Track
Location :
Scaffold_34:223675- 228602
Sequence
4927 bases(100 bases per row)
GACGGATCCTCCCATAAACTAGAGTGACTATAACAAGGCGGATAGAAGAGGATGGCGTAATTCATTCGCGAAAAATGTCATATGCGTCGTTGACGCTTGC
ACCAAGTAGTTGATGTTAAATTCGACCATCGGCAGAAAGTACGTCCATCCTGAAAGGATGGACGTACTTTTGAAGAATCTCTTCTAGAACACGGTTGCAG
ACATCCGTCTGGTCCTCAGTTTCAGGCTGACTAGATGTATTCTTCTTGAGGCATGTTCCGAGCGTTTTGAACACGGAGCGATATATATCAGCCGTGAAAC
GTGGGTCACGATCAGACACCAGTTCACTAGACAGCCCATGCAGGCGAAATATTGTGTCAATGAAAACACGGGCACAGTTCGATGCTGTGATCAAATCAGG
TACGTCAACAACTTGTCTTCTTGCTTAATCGGCATACTAACACAATTAACCAGTATTCGTGTGTGTCTTCGGGAACCCGACGTCAAAGTCCATTAAAACT
GATTCCCAGCACTCGGCCGGGGCAGGAAGCGGATGTGAAGGGGTATGGAGTAAAGTACTAGGTTTCACCCGTTGACATACTCCGCAAGCACGAAAGTACG
TGCGCACGAACTGATACTGTTGAGGCCAGTAAAATTCCCGACTCACCGTAAGATATGTTTTCTCACGACTACGATTACCACGAACAGGTGTGTCGTGGCA
CTCAAACATGAACCAAAACCGAAGATCACTATGGTTGAGTATGAAGACACGAGGCGTGTCCCCGGCAACTACAGAAAACTTCCGGAGGCCATTGCAAACT
GTGTGTACCCATCCGCCAAGGTCCGATACACCGTCGAAACTGTTTCAAGGTTTGCTGATAAGGTTGTGAGAGATGATTGTTCAAACTCGCGATCTCTAGA
TTACAAACATATGCTTTTCTTATGTCGTCCAGAAATGTTGAGAAAGGGACGCACAAAGTCAGCACCGCAACAATGGCTGTCCCACCTTTGGGTCGCACAG
CCGGTTCAAAATCGGGCCGGCGCGAGAGTGGGTAAGCGACACCATTTGGTCAAGCGACGACATTTGGTCGCTCTGGTTAAAATTCGACGGAGAAGTTATA
CTCCGCGAACAATGACATCCACCTCGCCATCCGCTGCGAGAGGTGTGGGCTGTTTACGGCCGTGCGTACAGACGCAAGGTCCGTATAGACGATAAAAGTT
CTATCGCCTAGCAGAAAGACTCTGAATTTCTCTTACGCGTACTCCATGGAAAGGATTTCCTTGTCATGGACAGGGTAGTTACGTTGTGCTGGTTGTATCT
GGCGTTACTGATAGCAGACGACACTTACCGCATCGTCTGCTTCGTACTGGATTAATGCACAGCCGATTGCAAAATCATTGGCATCACAGACCACGTGAAA
TGTCCTGTCTTGGTCTGCAATTGCCAAAACTGGCGAACGTATCAAGCTTCGCTTGATACCTTCGTAGGGGCACAGACGGTCGGCACTCCATTTTCACTTC
TTCTTCTTTTTGAAATGAGCGAGAGAAATGAACAGTAATCTCGTCGTAATTGTGGGATTATTTGTGCCAGTATACCGCTAGGCCACGAAACTTGCGAAAT
CCTTTTACATCTGCAGGCATCGGCCAGTTGGTGATCGCCTTGATTTTTTCCGGATCGGGCCAGAAGCCATTTTTATCCACGATGCAACCACGAAGTGGTA
CTTCGCTAGCAGCAAATATACAATTTTGAGGTTGGCGTACAACTCATTCTTTCGCAAAGATGTAAGAACCTTCCGGACGTGGAGTCGGTGCACTCCCACA
TCCGTCTGTCCATCCATATCCCGCATATGGACGAATACATCATCGAAGTAGCTGGGCGTGAACTCTCTTACAGATCTTAACAGATTCGTTACACATCTGT
TGAATGTGGCAGGGGCATTACTTAGCCCTTGTGGCATTACTAACCGCTTCCAAAGAATACCGATTGGGGTGCTCACTGAATTATAGGGAATGTACCTTTC
GCGCATAAGGATCTGATAGAATCCATCCATCAGATTCATTGATGAAAAGATGCTACTATTTGCCTAACCATCGATGATGACATCTCTCCGTGGTATCGGC
GTTAAGCCATTACACTTGCAGCATTCAACATGTTGAGAGCATGTCCTATTTGCTATCGTATGTGGCTTTCCGCACACAGAAGTTCGAAGAGCTATGTGAA
GAGGTCGAACCTCTCATATGGACGGCTGCTAAGCGATCTGCAAAGTATTTGTCGATCGCTAGTTCTTGTCCACAAGACAGTGGCCACTGCTTCATGAGAC
AGTACTTCGAACCCGGTTTCAGGTCGATTTCGTGATGAGTACTTATGTCTTTAGGTTAATCGCACGGCACTGCTTCAAAGAATAATTTCCTGACTCCTAT
CGAATCATTGTAAAGACGATTTGACTTGAGTGATTCCCACGATTTGGACGTATATCGCTGAATCCGAGTCTTTTCATCGAGATCACTCTCGTCCATTTAT
GAACTACTGAGAACTATTTCATCCTCGGCAAAGACCATTGTCGATCGGATATCACTGACGTACTCATCTTCCGCTACGCGGACGCAGATCTGCTTGACTA
TGTCACTACGCAGATCACGCAAGAAACTCTTTTGATTTAGCGGGGATAACTGAGTGATCTCCAAAGTCAACTTCGAAGGCGCGATCAGATCAAGTGTATG
GCTACGTATGCTAGATCCGTCATTCACCAGGACATTCAATGTATCTATTATTTCATGGGAACTTATTTTTCCACAGTCTGTTGGGGACTTATTTTCTCCA
CTCTAGCCTTTTTAGATAATTCATCTTCTTATACGCGGGGACTTGCTCCCTCGTGCCTTCTGACAGTGGTTGCTCTATTGCAGCCAGGTTCTCTACGTTC
GATTGTCCAATAGATCTAGGATCTTTGTATTGCCCATTATTTGAAATCGGTTAATTACTCTCTGGATATTGTTTAATAAGAGGACAACCTTGCCCCAGTC
CACTTGACTTATTCGAGAGGTGGGCCTTCGGCTCTTCCTGCGTTTCTAAACAGTCGCCGGGAACTTGCTCCACAATGTGATGATTAGTCACATTGCGATT
TTGTGCAGTCGTACAAACGACCGAACCACACGTGACGTCATCGCACTCACTATTAGTACATCCACATGATGATGGACACTCCAAGACGTTCATCAGATGG
CCATCTGGTGAACAAGCAGAAGGTATATCGACTGTTCGTCGCTGTCAGCTGACTAGTGGCTCGTTTTTCTGAGCCACGGTTAACCAAGGATAACAATAAA
TTTGTCAATCCAGTCCAATACGATGAAGTCATCGTCATATTGGACGTCTTCCAGTGTGCACGTGACCGTCTTGTCGAATTTGAATATCGACAGGAGTGTT
TGCCCTTAAGGGTGCAGTATTGTGTCCTTGGATTAATTTCTATGGGGAAGCTAGTAATTGCGAGCCCGAAGGGTGAAGCTATTAGTGAGTGTGCGCAAGG
TTGAATGCCGAGCTTTTATCGTACTTATCTGCTTATCTGTCTGTCGGACTATGTGTGCGTGTAAATAATGTGGTTAGGTGTAGTTTACACCTATTAAGTG
CGATCTAGCCTGTCCCCTTCTCATAGTATAGGTTTATCCAAAGTCACTCTTTGGCTAAGTCACTATTGTGGTGTACGCTTGTGATTGGCTTGAAATTGAT
CAAAGGTGGATATGATCACTTAAGCAAATGATGGCTGCTCATAATCAAAGGCTGATCGCGTTGCCCTAGCCTACTGTACTGGTTTGATACATACATTAAC
AGCATCATACTCAATCTTCAGTGTCTGCTGCTGTATAGTCTTTTGCAACTTGATTCAGTTCTCCGAACTGAATTACTTATGTCAAAGGGCGAGCTCCAGA
GCTTGCTCCCCTATCTTAACTTAAAAGCTTCCGACCATAGAACGAACACAGAACGACTACGTTGGACGTCCAATCCTATACATTATTAAAGGTTACAGGA
GGACTGTAGTATGATACAGTCATTCCTCGGATAACTCATATCCTTATAACTGAGAAACAATATAACCCATACAATTATGTTCCACCATGCTCTTTCTATG
GTCGTTAACTCATAACTCGTACCTCATTACGATTTGAGATTAATGAGTTTTTCGAGGGATAAAAAAATATGTCGGTACATAGAGAATATTGGCTTCCTCG
TATGTCTGTCGCGGTCCTTAAGATGAATTTATCCCACTTTTAATTTATGTGCTCGTGTCATGGTAAAGAAACCGTACGGTACAAAGCGCGTTTGCGATCA
TAGTAATGGTGGACTCTGCTAGTATTCGATTAGTAATTTCATCATCTAATACAGTTGGCGCGACTCGCACTAGATACAATCGGTCAGCTGTCAACCTTAG
ATAATAACATTCAAGCCTGTGAATGGACGAAGTAATGGCGGTACAAAAGAAATAGAAACTGCACTTGTGAGCCGGATTCTTCACATTATTTCACAAAAAT
TTCAACATCGTAAGCGTCGTATACGTCTTCATACGGCGAATGCGATCGCATAAGCTGGAGTACAATCATTGTGATCCCCACTCTCATCCATGCACGGGCA
GACGCAACTCTGATAACAAGACAACTGATATTGCTCAATAGTTATATATGTAACGATTGACTCTGTCCGACGCATCACCATGCCAATCGAACATTATGCC
AAGTAATTGAAGAAAAAAGCCCTATCCTGGTTAAGTTATTTTACGAGGATTATTAAAATGCTCGGTTGTTTTTGTAAAATGCCTGCATTCAGACAATTAC
TTAGTATGTCTCTTTTCCGGATGTATGCATACCTCTTTCTTCGCAGGTCAGATAGTCTGATTTGCACCTTTTTCGTTTCCTTGGCATAGTTCTGCCACCA
TCTTCGTGGCTTGACGATTCGTCTCAG