Description :
From Genome Similarity Track
Location :
Scaffold_335:22359- 24976
Transcript NameFunction/comments
Phypl_g7114hypothetical protein

Sequence
2617 bases(100 bases per row)
ATGGAGGCATTCAACAAGCGATTGGTGGAATTGGGTTGGGGCTATGAGAACCGCGAGagtcggtggtgctgcccagCTTTACCGATCATGAAACCAAGTA
CGAAGGACTTCAGACAGGCCGTTGACTACAGGCCTACCAATGCCATGACCGAGCCTATAGCTGGAGTGATGCCAAGTCTTGAGGTGGCACTAGAACACTG
CAAAATAATGATGTACTACGCAATGTTAGATTTCTTGAAAGGGTTCTGGCAGCTTCCTTTGGACGAGAGCTGCCGAGAATTCCTCTCTTATATGACCGAC
AAGGGTGTGTTCACTCCAACCAGAGTACCCCAGGGCAGTACCGACGCTGCACTGCATTTCCAATCCACGGTTGAAATGGTTCTCGGTGATATTGTCAACA
CCTGCGTGATCGTATGGATCGACGATCTTTTGGTGTTCGCCGACACACAGGAGGGTCTAGTTGATGCAATTACGGCAGTGCTGGTAAAGCTCGACGAGGT
TGGACTCATTATCAacccgaagaagagcgcgttGTTTCTCACGGAGGTTCGGTGGTGTGGACGCATCATCAACAAGCATGGAATTGGACACGATCCGGAT
CGCATTCGCGCACTACGTGAGATGCCGTCCCCGGCAACCGCGGCTGAACCTCAATAGTTCTTGTGTGCAAGCAACTGGATGAGGGCTGGTCTTGTTGATT
ATGCTCGCGTCGCCCGACCATTACAGGAAAGGCTTGACCAAGCACTAACTGGTACAAAAAAAACAAAGCGAGCCGCCGCTGGAATTCAGCTTAGCTTGTC
GGAACAGGAATTGGCGAGTTTCGCAGCTGTGAGAGATCTGCTGGCGAACTCTGCTATACTAACGTACCAGGATCCAACAAAGCAGTTAGTCTTGATGTCG
GATGCATCCGACTCTGGCTGGGGGCTGTTTGTATCGCAAGTGGCGAACTGGCAAGCTGACGTGTCAATTCACCAGCAAGACCATGAGTTGCTCATCTGCA
TGGGTGGCGGCTTCACTGGTTCGGCTCTCAACTGGAGTGTTATCGAAAATGAGTCGTACCCGATTGTTCACGCCTGTGAGCGTTTGGAGTATCTCTTACT
TCGGTCGCAGGGATTCAAACTGTACTGTGACCATCGCAACATCGTGTACCTCTTTGCACCTGGCAAGGAGATGAAAAAACACGTCAGGGGGAAACTGCTA
CGCTGGTCTACGAAGCTACTCGAGTACCGATACTCGATTGAGCACATCGAAGGCGCCCACAACGTATGGACTGATTTGATTTCAAGGTGGGGAGGTAAGC
CTcaacctgcagcacgaaTTCATTCGGCCAAGCGGTTTACGAGGGCGCAACGCAAGCGGGACAGCGGGATGTTGGTCCAAGGAAGGACCACTACTGGGCC
TACACCACTGCGTCCCATCGACCAGGACGGGTTTGTGTGGCCTACCGTCGACGAAATCGGCAGTACCCAATCACGGTATAATGCACCGAAGGGTGCAACC
CTAGGAAGTGATGACTTATGGCGAGTGAACGAGTTGGTCTGGATACCTACGGAAGctgtcgaactcgtccagcgactgtTGATTGTTGCACATTGTGGAA
GAAACGGATACCGCGGCATGCATGTGATGGAAACCCACATTCGCCGGTTGTTCTACATTGGAGGTCTCGGTAGGATTGTACGTGCCTTCTGCTCGAAGTG
CCTACTTTGCCTACATGTCAAAGGAGGGGTAGTGATTCCCCGTCCATTCAGCGAGACCCACCGCACATTTGAGCGCAACGCAACTTTACAATGGGACTTT
TGACACTGGGTGATTCTTTTGGTTCCTCTCGCTACGTGTTGGTTATAAAAGACGAAACAACACACTTTGTGGAACTAGTGGCTTGCGATGGATCTACATC
AGAGGTAGCAGCTACTGCGATCCTAGACTGGTACAGCCGCTATGGCGTACCAACTGCATGGATTAGTGATTCAGGATCACACTTCAAAAGCAAGGTGATC
GATGCCTTGAGCAGGCGACGGAAGGGCCGCCGGGAATTCATCCTAGCCTATTCGACATTGACTTAGCCGCGACCCAGTACAACGCAGCGCCTTGACGATT
TGCGTGATGAAATCAGGCCATGGACAAAGCCATCAAAGCTGAGCGCACTCGACAAACCCAAAGATACCGAGCGCGACCCCACCACCAACAGCAAGTGAAC
TTCTCTGTTGGCGACTACGTGCTACGCTCACGAGTTGACGAGAAAACTCATGCCAACAAGCTACGTATGATGTGGGTCGGTCCGTTTCGCGTGATTGGAA
GCGCGGGCTACTACTTCACGGTTGAACATTTGATTAGTGGCAACACGATGGACGTGCATCCATCTCGTCTGAAATTGTACGCAGATGATTCACTGTGCGT
TACCGAAGAACTACTGGACCACATCGCATCTCAAGggacgctgctggctgtaGAGGCGATTGTGGAACACAGAGTGAACGCAGACATGAAGGCCTACGAA
GCGAAAGTCAAGTGGATGGGCTTCGAGTCCATTGAAGATTCCTGGGAACCACTAAAGACGATGAGCGAGGATGTGACCCAGCTACTGCTACAGTACGcca
acgacagcaacgatGAC