Description :
From Genome Similarity Track
Location :
Scaffold_200:2235- 9529
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_200-snap-gene-0.28Protein arginine N-methyltransferase

Sequence
7294 bases(100 bases per row)
CGAAGTTGCTCGTCCCTGGCCACGTGCACCGGCTCACGAAGCGGGAAGTAGATCGGGAACCAGCTGAACATGCCGTCCGAGTGCGTAGATGGGTTAATAC
TGAGTGTGACGTCGTCAAAGAGCACAGCGTCAAAATACCCGGCAAAGCCGTGCACGATCGCACTCTCGAGTGCTGTGAACGCCATCTCCTCGTAGCGGCG
GTTGTCGATCCGCTGGTGGAACTTTGGGTGCGTGAACGTGAAGCACGCCTGCGACTCAGCGATCGAGTACATGTTGTGCAACCGCACGACGTACGGCGTT
TCAAAGTTCTTGAGCGACTCGTGGATCTTCACCTCGTTCCAGAGCTTCGACGACATGATCGGCGCCACATATGACGTGTACTCGCAGGGGATACTGATGC
CGTTTTCTAATCAGGATACATAGGAACATTGTTAGAGAAGATTGAGCGTACAAAGCTGTGGCGGTAGCGCTCACAGCGAAAACGTACCGTGAAGGAAAGC
CTGCGCGCCGTCCAGGCACTCGGGCGACAGCTCGTTGTCGCTGAATGAGCCCAAGAGCTCACTGACCATGATGTCCGCCTACAAAACAATAGACGCACAG
CACGATCCACATGAGGTACAACCCAGATAGCAACACGAGCCATTCGGCACGCGTGCCTTACGTACCTTCTCGGTGGTCTTCCAGTGGCGCATGTCGGACG
CGATGATCGTGACCGTGTCCCAGCGCTCCGAGATTTTGAGGTTGCGCAGCGTGATCACGGCGTTCGGGTTCTTCTCGACAGCAAACATACGCGTCTTGCG
GTTCGCGAGCACGGCGGCGCGTAAAGCGCAACGGACGAGCGGTCCGCGGCCGGCACCCACGACCATCACGACCGACTCCTTCTCGACGGGCGTCTGCTCG
AGGGCCTTGGTAATCGCCTTCTCGTACTGATTGTACTTGAACGCGTCCTGCTCGAACGTCTCGTACGTCTGGGACTCGAGGTTGTCCATGAGCGGCTGCA
GCGGCGCCTGCAGGTAGTCCAAGTACGGCGCTTCAAAGAGCGCCTTGGAGTCCAGCGCGTCCCTCTTGCCGTACAGAAAGTGCATGTACTGCACGTACGG
CAGGAAGCTGCCGCGGTGACGCGGGCGACCGGAAAGGTAGTACTGCACGTTGAACTTGAACAGGTCGGTGAAGAACTTTTGGTGGCGCTGTGAGAGCGCC
GGGTACCCCTTGCGGTTCGTCAGGAAGATGCTCGTGGGGATGATCACCGCCTAGGTGGCACAGTATGAACAGAAAGCAATTCGTGAGTCATTAAGCAATA
CGTCGGCGTATGGTAGGCAATTGGGCTGCTACGTACTCGGACAGGCTCGCCGAGCCAGCGCTTGAGCTCTTCGCTTGACGGCAGATCGGCCGTGATCTCG
AGCGCCACCTGCACCTTTGGGTTGTACTCGCACTTGGCGCGCAGCGCGTTCCAGGCCTCCCAGGGGCTCACCCCCGTGTCCTCGTCGAGTGAGATCTCCT
CGTTGTGCTGGAGCCCAGGTCCTCCACGTAGCAGCTTTGGTGCGCCAGTACCCACACGGTACGAGAGTGGGATGCGCACCCAGAACTGCAGGTACTGCGC
CTGTGTGACCGACTGGTTGAGCACGCGCGCGTAGTTTGGAGAGTTCGTGTGGTGACGCGGGGTTGGGAGCAGCACGGCGGGCACGGACAGGTGCGTGGCC
CACGCGACCTCTTGTTTGAAGACCTTCTCGGCCGCAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATCCACTTGGAGATGTGGCCC
ACGACCGACGACGTCCAGCCGCGCGAGTCCATGACCAAGTCCGATCCTGTGTGTATTTGCACCATACACGCATACAATGACAGCGCTATGAGTATGATGG
TGTATGTGTCGATCTGGTCTATTGATATCACTGGCAGGGAACGTACGTGATTGCGGACCATCTCGCGTATCCGAGACGCCATGGTCATCGCGCTTGAATC
TAACAAATACGATCACACAGCAGCAGCAGCAACACGCCACAAAAAAGAGTGAGCCTCTCTCAATATAAATCACAACGCCATACAAACAGCAGCGCCAATA
GCATGCCCTTGCGAGTGCCGATTGCGAGCGTACCTCGGGTGGAAAAGCGGCGTGATCACGCCGCTCATCTTGTCCTCATAGACCTGCAGGTTGGCACACA
AAGAAAGAGAAATATTGAGCGTGAGCACAACAGCGCATGTGGCGAGTGGACATGTAGACAGGTGAGTTGCCGAATGGGAAGCGCACCTTGTCGAGCGTGG
CCGGCAGGTCATGGCTGAAGGACGTCTCGAGCCCCACGAAGATGCGGTCACTGCTCATTGCTTTTGACCAACAATTCGATCAAATCTGTTGTGAGGCAGG
CAAATTGATCGCTTTGATTGGCGTCCAGAAAGTACTGTTATTTACTCGAATATAAGACCAATCCTTTATTCGAGGCGAAGAACAGAGTGATGGTAGATAT
ACATGTGGACCACATACATGGCTACATTATGAAGAGGGAGTTTTGGATCTTTTCAATCAACCAGAGACAGGATGTTTGTTTATGAGTTTCTTGAGATTAT
TGCGAATAGCTCTCTCAAGCACAGGAGCCATTTTTTCGTCCTCGCGTCGCCTTCTTTCATTAAGCATTCGCTAAACTATCTTCGCGCATTTGCTTTGTTT
GTCGGACAGACATGCTGAACGTCTGAAAATAAATAAAATGCTGCGCTTTTCCAAGGAGATCTAAACGAACTCCAGTGCCTAACTGCAGCAAGCAACAAAC
ATATTTCCACCTTCTCAAGAGTGCCGAAAGATTCGCTACTCTTCAACGTATTTGCCTTAAGCTTCGCTAACTGCAACGCCGCAGCACATGCGATCCTCCT
GCCTCACAAGCTAGTCGTCATGCATGCAACCGCCGTCGTGACACGTGCCCAGAAGAGCGGTATTTACTTTTGTAAGCTTCAACAGCCTCTCTCAGTCTCT
GTTGACAAGCAAGAAGACCTTCTAAGGAAGGGTAAGCCGATACAGAGCTCTCACAATGCGCTTTAAAGGGTGTTTGTGTGTGCGCGTGCAAGTGTGTGTA
GATTGGGGCTCCTCTTGTTCGCTCTTGTTATCGATCCGTAGCGCTGCAGCAGTTTGGTGGTGATAATGATGGTGGTGGCGTTTACAAATATAACTGACTT
CCATCGGTCTCTCATGCAAAAGAAAACGAATCGAAAGCTCTCGCATCCTTCTTATACTTTGCGCTACTTCACGCCGAGACACTCCATGAGTCGAACATCG
GGTATTTCGGTCGTCGATCTCGCTTGCTCGAGCGAGCAGGTTGCAGTACTTGAGCGCCTTGAGCGCAAGCTTCTGTTGGTTGCTGCTGATGCTGCTACTT
GGCGAACTAGAAGGCTCACTGCTTCCACAACCAGGAGACATCGTAGTGAGCGTTTGAGAAGTGAGATCACCGCTGCTGGTGCAGAGCGTCTGCTTCGCGT
TCACGAGGATGCGGCGCGCGTTCTCAGCACTTCTCTCGCGAAGTACTTTGCTTCGGTAGCAGATCTTGAAGCGGCACGTAGGCGATGAGGAAAGGAGCTA
CCGCTGCTGCATTCCTGCTGGGTCTTGCCATGTGAAGCATAGGTGACCGAGCGTCTGATGCCCGCGCGCTTGGAGATCTGCGATGCACCCAGGCTCTTTG
CTTGCATTTTGTCCTGTTCAGGGCGAGTCGGGATCACCGGTGTTGGCTTCAGTCGAGCGAGAAGCTGCTGCTTGTCTTCCTCGCGGCTCCTCTCCTTATC
AGGCATCACCTCCAGCGGGTTTTCATCGAGCCTGCCGTTCGTGTGCTTGAGCTTGGGTGATCGGCGCGAGGGCAAGCGCGACTTAATGCGGCGACTGGGC
GACTACCTCTGCTACCATCGCGAGTCGCGCTAGTCCTCTGCATCCACGTAGTGTTGGATTGTGAGATCGTCCCAGATCGTCCCAGAGGCGCGACGTGTCG
ATCACCGCAGGCTGACGCAGTGACTTGGCACTCACGCGCATCATGGTACCAAAAGGTTGACTCACAGGTGGATTTTTCTTCTCTTGATTGTCCCACAGGA
CACACCAGATCGCCTGCTGCGTGTATGCGCGCGTGTTTCTCTCCTCCTGTCCTTCCGTTGAGGGCAGCGAGCGAATTGGGAACTGGGGTGATCGATTCAT
TCTGTTTATTCAGTCGTGTGCAGGCTTGATGCTGCCTGTTTGTTGGCCGCTTCAACTGGGAAGAAAGAAGAAGGAATGGATCTATTCTTGGCCACCACCA
CCGCCAGACGTTTCACATCATATCTGGCGACAAGCCCCCCCGGATTCAAATTACCCGCCGACCCAAAACCGACCTTTTGGGGGAGCGCAGATATTCATTC
GACAGCATTTGTTTCTATCGTTTGACGAGCTTGCTTTGGCTTCTTGCAGACTCGTCTGCATGCAGTGTACGAGACTGAATGGGACGCATCACCCCGCCTG
AGCAGAACGGAATTCTGACGAATTCAGTTTGCAACTTGAGGTGGATCCGGAGAAGCTGGAGGTCTCTGGAGCTTAGTCATGTTCAGCGGTGAAGCCAGAG
TGCACTCTGCGAAACGACCTTGGCTTCGCTCTCCTACAATGTATTTGTGAAAAGAATTCTGCAAATGGACAGTCGCGAGTCAAAAAGACACAAAGTCTAT
TGTTCCTTTCACTGACGTTGAAGCTGCCCGCAGGAACAGGTCAGAACGGCCAGCAGTTGCTTATTGCCAACCTCCCACACGCCCCCCAGTCGTGACACAG
CACGCGCAGTGCGTGAGCACGGTGCCCGGGTGATCAGACACAGGTGCATAAACATGCAGCAGAGTATGCGGAGTCAAGAAGATACAGTATTTACGATATA
CTGTAACGCGTCCATTGGGCTGACTCCATCTACTACTGGCCTTTCGCACGCTTGATCGGACTGAGGGCTTTGCCAAGAGCTACAGAAAATATCCGTATTA
AGCTGGTCGACATGACAGATAGTAGATACATAAAGAGGAGCTTACAGATATTGCGAAGCTCCATGCGGCCAGTCAACTCAACCACACCCTCTTTCAAGCT
GTAATAAATGTAATTGAAGCTGCTGGCCAGTTTGTCACGCAAAAAATGGATAAAAAGTCCCTTTGACACGGTTTCACAAATGGGTACAACGTCAACAGAA
GCGCGGCTTGTTTTTATCACTATCACGATTTGATTGGCAAGCGTTAGCCAATCAGATCAACCAAAATGCGATCTTTTTCTGGGAATAGAAACTAGGAAGT
GAACTCGGCAGCTTCGACATCAGCTCTCTGTTTTTTTTATCGTTTACACGATTTAAGTTCAGAAATGGGATCGTCCGTGCAACAAACGAATCCCTTTTTG
ACCTCCAGTCCTCGGTTACGGTCGCGATGCTTAAGACTTTGCTGCGCCGACGGGATGCGCAACCTCGCCGCTGGATCCGTTTTTGCCTGATTGTTGGTTT
ACGAAAGCCTTCCTTGCTGCTCTGCTCCAACTGCAGCGTTTCACAGTGTTATAGTTTTGTGTGCACTCCACCTAATATCAGCTTTGTAATCGAGGTGATC
AGATGATGTGCTCATGGAGTTTGTATTTCGTTTAACAGCTGATCACAACTTGTTTGATTTACTATCGTTCAGAGTTTGACCATAACAAACTGCGTGGAGT
TTGGGGAGTCCTTTACGCCTTGCAGCAGTCAATGCTCTATGAATGTTGTCGCCTCCAGTCATTGTGTCCGGATAGATACGAGGATGTACAATCTCTTAAA
AGTCATGATAACTATCTTCAATATCACGATTTACTTGACGCCTTCAATTGCCTCCGGATTTCTCTAAGACGGATGTGGTGATTTTTCAGAAACAGTAACA
GAAGCGTTCATTTGAGCCTAAACAGTCTCAGTTCAGCCCTCAGCCATAGAAGGAGACCCTGCTCACATTTGCTATCTTTCGTTGCTGTTTCGTTCTTGCG
GTTCATTCAAAATGAAGAATACGACTAACCATTGCGCCTCACCTGGAAGGATATACAGATGAAAGGATCCTTTTAGGCGCCAAGCTCAAAAACCCCAACG
TAATAAAGGGATACTATATAAAACAACTGACATGGGGGTGCAGCCTTTTGGAGATATTCAGTGAAGTCTCAAACTACGAACACGCAGACACAGACGAGTA
TAGCCTTCCCTCCCGACTGTCGTTGAGGCACTGGTCCGAGTGAGAAGCGGGGGTGGCAGACAACACCAGCGGCTCTCCAGAAGCTGTTCGCTGGTCCTGC
CTTGCCTCACGCAAGCAGATCTTCCATTTTGTGAGATAGCGCGCGAGCATAAACAGCACGAACGACCTCTCGTCCGACTGATTCACAGTGTCTTGGAGGT
GCACAATTTGGTAGTCATTCCGAAAAATAACGATCCCTGGGAGCTTGAGATTACAAGTCGCATTTGCGTGATGACACCCGAGCATTCTGGACTTGCCGCA
AGCAAGATCTCTTGAAGAGCTGCTATGTTTTTTTACAATGGGTAAAGGAAGTTCAGAGGCAACCAAGACATTAGTGTTTCTATTATAGTCGCGTCGCTAA
GCTCGCCCCGCGTGCGTTGCAGAAGTACGAGAGCAACAAACCGTTGTGTTGTGAAGGTGGGATTTGGTCCTGAGGTCAAGATGGGAACAGGACTTCCATT
TTTTGAGATGGTGGAAACTCGACGAGGGCGACTGCGCATTTGATCCGAGCGCACGCGCAATGCACACGATACAACACGGGACTGGGCAGCTTAAATCGTT
TATAATTTGTAGCTTGAGAGTGTGTCGAGCTCACGAACCCTGGTCATGCTGAGCCATGAGCTCGTTAACCATTCTCAACTTCATTCTGTAAGCTGCAACA
AAGTGCATGATTCCGAAAGTCAACTGGAAATCCCCAAACTCAGTGTTTGACGCACTGACATGAGAACGAAAAGCACAACAAGGACAGACATATTACGTCA
GGGCGTTTGCTATCCACCTCTGCAAAATGCACAGAGCAAGGCACAAGAGATGATTGCTTTTTTAATGAACTATCTATCTGTTCAACATCTCAAGATCACG
GTCATTTGGGTGCACCCAATGGCTACAACAACATCAAAAACAGATGGAGAAATTCTCTGTTATATTGCTCTTTTTAGAGGCATCTAATTGACAGTGATAG
TTTTTTCCCCCCCTAGAAATCGGTTGACTACAAACACAACTTCAATCAACAACGTCTCCGCAAATTCCCTTGATGCCTAACAAATCAACCAAAC