Description :
From Genome Similarity Track
Location :
Scaffold_28:2235- 3653
Transcript NameFunction/comments
Albla_Nc14030780Amino Acid/Auxin Permease (AAAP) Family putative

Sequence
1418 bases(100 bases per row)
GTTGTAATACAACTTCGACTCGAACTCGGGAGCACAAAACGGGAATGGAGGCACATTCTGAGCTGGAAATAGCATATCTCGACCACTCGTGTACGTGACA
TAACAAGCCAAAACGCTGCAAATAATAATAGTTGAGATCGCTGGTATTTTTTCATACAATGGAACATGAGGCCACATTTTCTTCAAGTAGAAAGTGATCG
GCAAAACAATACAACAGACTGATTGGCATGATGCACCAATAAAATCCATAAACGCGTTCAAGTGAGAACGGCAGACGATGGCGACCACGACCAAGATTGA
AATGATCATAATTCTCAGCGTCACATATTTCACGATGACGTCAGCACGGCGATACTCGTTCACCAGTTCTTCTTCATTTTCATCACCAGCAACGATCACC
AATGAGTATTTGCTGGATCCTCGTTTGGAATTGCTACGCTCTGCCATTCTCGATGGCATCTCAATATCATTGTATCGTGTGCTGTTCGTGTTTTCCTTTT
GCTTGTGCATTCCTAGCAAAAGCCTTTCAAAGCAGAAGAATGCCGGGTGTAAAAATACAAAAAATGCGATTGAGACGTGCATCTGCATAAAGATGAATGC
GACCACGGCGGCACCTTTGTTTGGGCGAAACCCAAGTGCACTTAGCCCACTAGAATCCGGAAAAATGGAAAATAGCAAGTTGCCTGAAATTTGACATCCG
ACAGCTGAGTAGCCTGCAAAAGCCAATGCCATAAACATGCAAGAAATGAGCGCCATTGTGCAGAAAACAAGTCGAGGCATCCGTGTTGGTTCCGAGTGCT
CATTTTGTAAGGATGGGATGATAATACCCGCGCCAAACGCGAGACATAAATTTCCAAAGGCTCCGGCAACCTGCTCGAAATTTAAGTCAGGTTTTGGAAC
CGAAGGATGCCCCGACATGCCATTCACTAATAAGACAATTGCAATGCTGTCTGCTACGAGAGTGCCCGCACACCCAGCTAGCGTGGCTCCCGCGCTCTCC
TTCAAAGTCGGCGTTAAGCACAATGGTAAGATGGATATAGCCATGAAAATGATCCAGACAGATTGCGAGAATGTTCCAGGGAACAAGGACTGTAATAATT
GCCCACCCAAAACCAGAAAGACGGCAGGAGTGAGAATACAAACAGACATTTGCGAAAACAAAACTGCATAGCGTCCAACTTTTCCCAAAGACCACTCCCC
GAGATCACTGAATGTTTTGACCCACGAGGGCGCCAACAACATAACTTTTGAGCACACCACTGAAGCGTAGATATTGGCATACGTCATAAATATCAGTGCG
CTGAAGCCAAGCGTTGGTCCTGCCCGAGAAAAATCACTGGGCATACCGAGAGTTCCAATTCCCAACACGCAACAAAATAAACTGAATGCGATTTTCATAT
CTTCTATCGAGAAGAAAG