Description :
From Genome Similarity Track
Location :
Scaffold_19:223495- 225850
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10236fatty-acid-CoA ligase
Phypa_INRA-310PPTG_10237hypothetical protein

Sequence
2355 bases(100 bases per row)
GACGTTCCAGTTGAGGACGACGGAGGTGATGTTGCTGTGGCAGGTGAGACGATGAACCGAAACGTCAATGGTCCTCGCGTTGCCTCTACTGATGATGGTT
CCAAGTCGAACTTACCGTCGGTGATCACGGGTGTGCCGCCTGACCAAGTACACGCATTCTTGGTCGAAGAACTGGCCCGTACTCTAGGCGTGGAGCCAAC
ACAGATCAACGACGACACGCCGCTGCAAGAACTTGGTCTGGACTCGATGGTGTTGACTCAACTCCAAGGCGTCATTGCGCAGAAGTACCAGGTTCATGTC
GAAGAAGAACTGCTGTATGGTGAGACGACTACTCTTGCGAGTCTCCACGCTGGACTATGCGGCGAGACGTCCGGTAACAGGACAGGGGGCACATCCGCCA
GTTCCCCGAAGCAAAAATTGTTTTGCGGATGCATCGCATGCTAGGAAGGATGAAGAGAATGAAAGATACTGCATGGTAATAAACATACACAAACGTTGAA
GAAAATTACAGTTTAAAACAGCTAGAGCAGACAAATGTGTTTATTACAAGACAATTCAGACGTGGCACTTTGACGGGCGAAGCAAAAATGCAGAGATCAG
AGTAACAACGACACGGGGGATAGAATCACTCAGTCGATGTACTCGATAGAAGCCGATGATGGCGGTAGGGCGAGCGTACCTTTGTCCTCCACACTCTCCG
GCGGGGACATCTGGTTAAGGTAACGTTGCTGCTGTGCTGGGTGCACCTGTCCTCCGTATGCCTGCTGCTGCTCCATGATCTTTTTGCCCTCGATAAACAT
CGAGCGCAGCAATGCCTGCTGAGCCGCAATCTGCTCCTCCATTTTCGTAAATGACGTCGGTAGTGGCGTAATGTTCTGCACCTCGTCGGGTTCCTCCAGC
AACACAACAGCGTCACCTGCAATGGGCTCCTTGCGGCTCTTGATGTCCGAACTGCCACGGTCGCTCTGCGAACTGATGCTGGTAGAGGCGCCCGAGGCGT
CCGAGTTGTGCCGTCGTCGGTCTCCGGATGCTTGCCGCGCGGTGCGAGGTACACCGATATCCAGATTTCTACTACTTCCTGCCGACGTAAGCGTAACCAA
CGACTGCTCCTTCGCTCCATCCGCCGGTTTCTCTCTGTTGATAGCGGAAAGAACCTTCGTCGACCAGCCAGCGTACGAAATGCCCGACTTCTCTCCACTT
GTACCACTGGCTCCTCCTAGTGAACTCGTAGAGGACGATGAAGACGCAAACGAGTGGTTCTGCTGGGGGTTGAGTTCTCTATCGGCCGAGTGGTCAGAAA
TGGAGCCCCGAGCAGGCGGCACTTGGCCGTAAAACACCTCACTAGCTCTTGAGGCATAGGACGACGGCACGTTGCCATCGTACGCCTCGTCCGAGGCGAG
ATCGATCCCTGCGCTCTTGGCTGCAAGCGCGCTACGACGCTCTTGTCGGGCCTTGTTTATACACTTGAGGCAGAACTTTTCTACGCTGACGATGAAGCTA
TTGCCTGTTTCCGGTAGCATTCCTGGCGGGAGCTTGCTGGACTGGATACCGAGCTCGATGGTGCAAGCTCCGCACATGATTTCAGCACACACGCGGCAGT
GGTGACGCGACCGCAACAGGTTGAAGCTCTTAAAGCATACAGAGCATGCCGGACGCTCGTTGTTGGGCACCCACGCCTTGTCTGTAATCATACGACCACG
TACGAGGAACTTGGCGTCTGCAGCGGTGGCGTGGTGAAGAGCCACAGCGAAAAGTGTCGATACTACGCGGTTCGCGAACCAGCTCGGAGTGTTGCGGTTA
TTGTCGAATCGGTCTTCCGAGAACATCGACACGTCCACTTTGCCGCTGGATGGGCCCATACTACGGAACAGCCAGACCCAGGTACCTGAAGTGCGAGAGA
ATCCAAAGTTGCGCTCGTTCCCATCGCAATCTGCCATGCTGACGCTCTGCTGGACTTTAACCAGCACTTTCTGTCCCTTGGCGTCCTCCATCGTCTTCGA
AAACTCGACAACAAGCGTGTCTCGGCAGCTGAACACTGAGTCTACGGAGCTCTGGAAGGCGAGCCATTTAATGCCGAGGAACTGGAACGAGTCGTCGTTT
GTGGCCTTCTCGTGCACCTGCAGCACTGCCGAGTCGAGGAAACTCTCCTGATAGCAGTGAGCCATGTAGGCGCGCTGGTCTTCCGTTGTGGCACAGTTGA
CGGCGTATTCGAGCTCTTCCAGCGACGTGTCCAGCTTGGCACGTAGCATGGCCTTCCTCTGCAGGTTACTGGCGTCTGCTGCTTCTTTCAGACGGTAAAT
GACGCAGTTTTTCTTCTCTAGATGGGGTTTCCAGCTCTGGTTGCGGTACTGAGGA