Description :
From Genome Similarity Track
Location :
Scaffold_215:22348- 27471
Sequence
5123 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTAAGAAGCTGTGTAGCTCCGCTACACTCGGTAGCACTCGTAGTCAATCTACGCCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAACCCCACTCTCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTAGAATTCCTTGTATCGCA
AGGCCCGGAACTGCTGACTGCACGTGTTGAGGGTATGAAGCGTTTCTTCTAGGGCAGGTCCAAGACCAGATGGCGTCGGCTATGCCTACACGCTATGTGT
CTGTTCCAGACGAAGAGGCTAGGCGTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGAGGGTGAAAACCTCATCCTCTAGATCCGTGAGAT
TGAGATGGTTATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCGATGGAAGTGCTAGGTAATGGGCCTTGGGA
GTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTACCGCGTGCGTTCATGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTA
ACGGACTATGTCCAAGAGTTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAAGCAGTCCATGTGACTGTATTCATGGAGGGTCTCCGTA
CTGGCGTTGCCAGAACCTAAGTCTTTCGGGTTCACCCTCTACATTCGAAGATGCTGTGAGAATTGCTCTTAATGCTGAACATAACTTCAAGTCGTTCAGA
CTTGGCTGGAATGGTTACAACCCTAGCTCTGCGAGAGCAAACTACACGAGTACTCCGGTCGTTAATAGGCCGGAACCGATAGATCTCAGCTATGCTGAAG
ATGAAGGTGAAGTTGAACTTCAAGCTGCTGATCAGCAACGTATTGTACGACGGTGTTATACGTGTGGAAGCACTGAACACTTACGGCCTGGTTGCCCTTT
ACGTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTCTGGCATGGCACGGGGAAATGCCGACACCCAGTAGGCGCGGGGCTCCCTA
CTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGCTTAGCCCCAAAGAGTTCCATACCTATTGGTATGGAGCGTGGATACAA
GGCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAAGGTCTGAAAAGCCTTGGTCGATTTTAATCGATTTTGGAGTGTCTTGCGATTATGCTCGACGTCGT
TCCCTTAAGGAAAGTCAGCTTTATGCTGAAGCGCTTACAGAGCATGAGGGTGATTCAATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTA
AAGCTCCGTTGAACTTAGGTATAAAGTTTTTTGACTTTGATAGCATTGAACGCTGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTAT
GGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGAGGTCTAAGACCTTATTCGAAACGTGCAATGTTCCTAGCGAAGTTTTGGAGAGTCATGAACCC
ATCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTCAATATGCTGGACATTGAAATATCTGAGTTAACTAACTCCAATGTTG
AAAACATGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGATACGGCACGTATTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAG
CATGGTTGGCCTAGGACCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTGGGGTGACACGTGAAAACTCACCGAGTGCGGTCAGCCGTTAAGGCACC
ACACTTAATGTCGGTAATGACATCAGCTCTCGTATGGAGCGTACTACTACTATTAGTAACCACGGGGACACTATTGTCCCAACCCTAGAGGGGTGTAAGG
TCTCATCGAAGCGACGACCGGGACGCCAGGTGGCAACTGTTAAGCGCCAGGCGTCCGTGCAGTTACATAGTGACAATAATGATACACTATATACACTTGT
CAACGGAGTGACTGGCCAGGTTGAGGGCAATGTCAGCCTAGAAACCCTTCCATATTTGGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGTGAGTTT
AGCCAGGCCTTGAAGGCAGGAGATTTATCCGAATTAGTGGTCTAACGACCACTAATTCGGTCATTAGACCTGATTTTGAGTTGAACTCGTCCTCATTAAT
GGATGAGTCGGTCCTAGAGGATACCAAGGCGACAATCAGTTCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCCTTCTATCCTTTGGTAAAG
GAATTTCAAGATGTGGTGTGTCACAACCCACCATCTATCTTACCTCCCGGTAGAGGTGGACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCG
TAACACTGCAGTGGCCTTTACCTGAAGAACAGCGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCC
CCATTCCACACCTACTATTTGTGTCAAAAATCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAACAAGCTCAATGCTGCCACTATCCTGGCTCAGACA
CCAATCCCCCGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCGCTAGACTTAGTCGATGGTTATTACCAGCTGCTCATGCTAG
CAAGCGATATTCTTCTAGCAGCGGTTAGTACCCCTACCCGTATGCTTTGGGAGTGGTTCGTTATGCCACAAGGGCTGTCAAATTCCCCGGCTACTTTTAA
TCGTCTAGTGACGCAACTATTCCGACCTAATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGGACGGTCGATCTGAT
GTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAATAAACTGTATGTAAATGCATCTAAGTGCATCTTTGGTGCAGAAGGGA
TTCACTTTCTGGGGTGCTTCATTTGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGATAAAGGTCATAGTCGATTGGCCGATTCCTAAGAAACAAAAAGA
TCTACGTAAGTGGCTTGGCCTTGCCAATCACTTGCATAAGTATAGTGCGAATTACGCAGATATGGCTCGACCATTATCCAATCTCCCTAAGAAGGATGTG
GATTGGTGTTGGGGTAACATCGAACATGAAGCTTTTCAAGCAGTTAAGGAAAGCTCCTTCATGCGCCAATGCTATCTTTGCTCGATCCTGATCGGCCTTT
TAGTGTCGTCTGTGACGCAGCTGACTTGCCACAGGCAGTCCTCTGTTACATACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCTTGACAGC
TCAAAGCTGCTAAAAAGAATTATCCAGTTCATAACAAAGAGCTACTTGCTATGAAGTGCGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTTAAAGCC
ATTGTGAACTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGATTTCATTCTTTGCCGAATATA
ACTTCGAAGTGAAGTATAAGCCAGGAAAGCACAATGCTTTGGCTGACGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCAAGTCATTACGCTGTCATC
GTCAGTCACTGGCTTAATCTGTGCGTCTTATGCCAAGGATGAACAATGTGTAGCTTTCCTACGTGCTCTTGGCAGCGAGGAGTTTAAAGACTCGGCATAG
AATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGT
CCCTCATGATGAGAAGTTGAATTATCGAATACTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGC
CAGGCTTATTGGTGGCCCAAACTATACAGGTGGATGAGCACCTATGTGCGTACGTGTAAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCGGCGC
CGCTGGCTAGTCTGACTGTACACTCTGGTTGTTGGGAGTCCATCAGCATGGACTTTGTGTTTGGCCTACCGAAAGATTCGAAAGGCAACACTGGCATTGT
GGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGAGGCAGTGCCAGACTCTATTAATGCAGAAGGTACAGCAAAGCTATTTATCAACCTTGTGTTT
TGACAACATGGCTAGCTTGTCTCTGATAGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACTTGTCCA
CAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTACGCAGTGTTTTGCGCTGATAAGCCTATGCGTTGGA
GCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTGTTCATGCCTCGACAGGCTATACTCCGTTCTACGTAAACGGTCTCACTCACCCTCGCGT
TCCGTTAACGCTACCACCATGTGGTCCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCTCATATCGGCCCTGCTACTGTTCAAATACAGGTAGGC
GAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGTCAAGACCAACAAAAGCAACAAGCAGATGCTAAAAAGAGAG
GTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTTAAGACAAAGTTGCGTCC
GCGCTTCATTGGACCATTCACGGTCGTTGCTAGGAACGGGCTTGGGTATACGCTCAGCTTACCACGAAAATTGCGCACACATCCGGTGTTCTACGTGGGC
TTGCTTAAGCCGTATCGGGATCC