Description :
From Genome Similarity Track
Location :
contig_200:22348- 26413
Transcript NameFunction/comments
g14210.t1hypothetical protein

Sequence
4065 bases(100 bases per row)
ATGTGCAATTCAACTTTATCATGTTGGAAATTCAACTCACAATGAAATATCACGTTGAAGTTGTCAACGCGTACAGGTATACCAAAGTCTCTGTGCAGGG
GTTTTGGGTCTGTGTCGGGGTTACTGGGCAATGAGTCCATTAACGTTAACACATCAGTACGAGTGCTACAGAAGAAAAAATATCGAAGGCTTCGTAAACT
ACGACAGCAGATACGACTCCCTGTCAGATGCCGAGGGTGAGGCTCACTTTGTGAATTCACCTTCTACCAACGCCGCTGAACAGGCAGGTATGTTGTAGCG
CTGCAACCCGATATTTGTGGTTGGCAATCGAGGCCGAGCGAAGCAAGGGCGACGGGCAGCAGTCACCCGCCCTAATGATCACCACTGTTGTACTTTCCTC
TTCGAATACTTTCCTATTCGAATCTGGAAGCTCGACTCGACGCGGGTTGCATCTTCAAGATGAACTTCAAGATGAAGGAGGCTGCGAATGAACCGGACTG
AGCAGATTCGGATGATCACCGTGCAGGTGACTTGGTTAACACTCTATATGTATGGATAGCTAGATTCGACTTCATGACTAGGCAGTGCTGAAGGTTTTCT
TTGCTTTCCTCACCAGGCTCCAAACAAAAATCAATTCCTTCTCACATTTACCTCCAAATCCTCAAGTCGCCTACTAACTCCAACACCAACAACTTCCTCT
ACTTGCCCACCAACTTCGTCCCCGCTCTGTTTCCAAGCTCCAACTCCATTGCACCCGGCAGGCCGAGCCCCAAGGAATTCAACAATTGGTAACACTTGCT
TCCGTCTGTGGAGGATTAGGAGAAGTTTTCGTTGACGCCAAGAACCGGTGCCCATGTGCGAGCCGCCGCCCGCATATGTGAAGAAGAAGTAGGCCGCCAT
CGCACGTCTCGCGGTGACCATGGTGGCGCAGCAAGAGGAGTTGAGTAATCTAGTAAGCACGTTCGCGAACAATCCACCCGAGAAGTGCCGAGTTGAAAGC
ATGCCCATGCCGACATTCGGGGGCAAGAAGAGCGTATCCTTGGATCTGTTTCTCGACCGAGTCCTCATATATTTGGAGGCGAAGAACATTGATTATCACG
CCGCCTACAACCACAATGAGTGGTGACAATGATGGCCTCTCACCTCAAAGAGCCTGCCGCGCCTCGAAGTCATCGCTGACTACCATGGATTCATTGGCCG
AAGACCTTCAGCATGAATTTGTACCTATCGATCTGCAAGAACGACTTCGAAGCGATCTTCAACAGCTATGTCAACGTAAATGTTCTGACCTCGACGACTA
CATTGCCCAATTTCGACAATTGCTGTCGCAAATTTGGGCATCGTGGCTTGGACCAGGGCACCTGGTTCATTCAAAGCCTCGTGCAAAAAAACTCGGGAAG
AAGTCGTTTATCGTCGGTGCCAAACGGTGTCTGCAGCTATGACAATAGCTTAACAATATGAGCGATCTCACCCGAACAACTATCCTGATTGGAACGGCGA
AAATAATCGCTGGGCACAGCGTGAACGTATGCCGGTTCGCTCAGCACGACCTCGATTTCCCCCGCCGGATGATCAGCCTGAAACTATGGAGATTGGACAT
GTCTAAGTCTCGCGTGAGCAGTGTCGCCGTAAGCGACTTTGCTACTATTGCAAGCATACAGGACACATGCTTGGTTGTGCCCAAAGAAGGACAGCAGTGC
TTGTAACAGACGTGTCTACGTCTCGGAGATGAGTCCAATCCAGTCATGCGACGCTCAAATGGATGAAAGCCCACCGCCAAGGTGATTCAGCTTGGGTCGG
TATAGACAATGGTGCTCATCATGAGAGGTTGCGACAAATTGACTTGTTTCGCAAGAATGCTGAAATCAACGGAAAAATTGCTCGTGTTTTGATTGATACA
CCAACTTGATCAGACCTGGTTATCTGTCAGGGCAGTTGGTTGCGCGCAAAGTCAATATCGAAGGATTCGATAGTGGCAGACTGTAAAATTTCGGTACAAG
AAGGTGCTTGTACAATCACATTGGACCTGCATCAATTTTCCGGCGTCCAATTCACGGAATTCGAGCTACCTACTAGTCACGACGTCATTCTGGGAAGCCT
TGGTTAACGCAATTCAACCCTTACCTTGACTGGATTACACATCAAATCACTCTAGATCTCCCGTCAGCTATGCCGACCTCAATGTGCTGAATTTGTCCGC
CGCATACAAGCATGAGCCGCTACCAGCACGTGACTGCAACTCTGCTATGTCATCTGCACTACCAGAACTCCCACCTCGGTCTCCGTTCGGGTTTGAGGCA
ATTCTGGATATAGAGCACGCGTTTTACATCAATGTTAAGGCGTTGCAGATGAAGCTAACATGACCTCGCTACGAGCAGTCATACTGAACGAGTTTCATGA
CGTAATACCCGACAACCATCCCGCTGGACTTCCTCCACAACGTGCCGTGGAGTTCGAAATAAATCTGAAGCCGAATGTCACGCCTCGGAATCGCCCACTA
GTCCGACTATCGAAAACAGAGCAGAGCGCACTCGACATTTTTATATCGAGCATGTTGGAAAAAGAGTATATCAAGCTGTCGAACTTACCTTGGGTCTCGA
ACGTGTGTGCAGTTCCAAAGAAAACCCAGTTCTGGAAAGGCTCCGAAGAAGTCGTAATGGGTCAAAGCCGGCGATCCATCGTAGCCAATTCGCTGGTTGT
AGACTGCAGATTTCTCAATAACCAAACACTCGTGCCCAAGATCCCATTCCGCACATCGATGAGTTATTTGATAGAATGAGTAGCGCAATATTTTCTTTCA
ACTCTTGATCTATCAGCTAGCATGGAAATCGACGCCCTTACTCCAGATGATGATGAATCAAAAACCAATCGCGCCTAAAAAAAAGGTCAGTGTAGAAGAG
TTGAAGGACGACTTCGGTCCAAACCCCAGATCTTGCGGTGGTAAGCTAACTGTTCTGCGTGGCAAGAACCCGTTCAAATTGCCCTCACCCCGGAAGAAAA
CGTCGTCTCACGCGCAGCGTCAGCGCTAAGAAACTGAGGGCATCGAGACTGAAACTCAAGGTGCTAAAACTCGAGGTGCTGAAAGAAGAGTGCATGACGG
TGTGTCACTACGTCGCTGCAACCGGTGGGCTGCACACACATACAACGACCTGATATTGAGTGAGCTGTTTGCGTATTTTCCAGTCGTAATACGCGGGAGT
TCAAAAGAAACTTAGAACGGTGGTGACGGTGGTCGAGACACAAAAACCGGTGGTGAGTTTAGCAGTTGTATTCGACAACGAAATACGTGACTAGTGCAAT
ATGGAGCTCCAAAGCCGACGGTGCCGCCTAGTTGCGGACTCAGCTCAACATGCATCTGAGTTTGGTGCTTTATTTGGCGACGACTACTAATCAGAGTAAG
TATTGAGCGTGCTGATCAATAGTTTTGATTGATCGACTCTAACACCTACCCTCTACCCTGCATTGTTGTTGTCTAGGAACCTTGCAAAAGCCATGACAAT
TTCAGAGCCTACGCAATGCGTTGTATCACAAGCGCGACGTCATCACCTTCGTCGACAGAAAGTAGGCGGAGAATGAGTGTCAATATAGATCATTGTTGCC
TTATGGATAGTTGGATCAGGAAATATGGAAGCCGCCCTTCATTCAAGTTCGCTGGACGCAGGTGCGAGAATTAGCTTGCAGTTGAAGCCTGGTTCACAGA
TTTCTATCGCGGTTAGAGACATCTTACAAGTGCTACGGCTGACAAAGTAGTTTACCGATCGAACAATCTGCGCGACGCTTCAAACGTTTTACAATTTCAA
TCATGAAGCATATTTCTTGGACCCGCTGGTTGAAAAGGGAATGAAATGGGCAATACCAACCAACCAAGAGTGGAAGCTGGTCATTGCACCATGTAACATG
AATAATATCCACTGAACGCTCGTGATTGCTGCTTAGACAAGCATACGGTGGTTGTGTACGAGCCATTGATGCAGAGCTTTTACTTCGATCAGACTACACA
TTGGTGCAAGGGCGCCATATTTGATGCTATCTATCAATGGGAGCACAAAACCGGAAGGGATCACT