Description :
From Genome Similarity Track
Location :
Scaffold_402:22345- 23484
Transcript NameFunction/comments
Phyta_totarag7963hypothetical protein

Sequence
1139 bases(100 bases per row)
ATGAGTCGATGCCattcagctgctccagcgcgagCGTCAGGGACTGCGTCCCCAGGCGGCCGTGACCTTGGGCCTTGACAGCAACGTACAGCTGGTTGGC
GAGGGCAAGACCGGGGAGCGACAAATTCATGCTGCTCAAACATTCAAGCAATCAGAGGTAAGTAAATTTGAATTCCACGTACACATACACCCCATCCAGT
GTCACAGTCCTTACCTCTCGGCCTCCTTCAGTGCGATACCCATGTCTTTGATGAAGTGCTCCACGAAGAAGCCAGGGTCGAAGTTGCGCTTAGCGATTCG
AGGTCCGAGGTTGCTGATCGACCAggagccagcagcacctgcgctCACAGCGCGGATAGCCTCCTCTACGTCCAGCCCGCTCTTCTGTGCGTACAGAAGG
CCCTCGACGACGCCAATCATGTTGGTGGCGATAAGGATCTGGTTCACCATCTTGGTGTgctggccagcgccagcgccgcccATGTGGCGGATGTTCTTGC
CCATGATTTCAAACAGTGGCAGCGTTGACTccacggtgctgctgtcaccaCCGACCATGATGGACAGAGTACCCTCGCGCGCGCCGACATCGCCGCCCGA
AACGGGGGCATCCAGGCTCGAGACGCCCTTCTGCTTGGCAGCCTCGTAgatctccttggccagcgaCGGCTCACTGGTGGTCatgtcgacgatgacgccC
CCTGACTTGATCGTGGACAGCACGCCCCATTCAGGATCCAGGAACACCTTGCGCACGTCGCTCGGGTAGCCCACAATGCCGAACACGATGTCTAGATACA
ACCAAACAAAgcacgtattaatacaagtTAGCTTCAAAGAGATACAAACGAGGCAAACTAAGATGCTGTAACAGTGACAACGAACCGGAAACCTTCGCCA
CCTCGGCGGGGGAGCTGGCGACCTGCGCGCCTTGCTCCTTGAGGCCGTCGCACTTGGACAGCGTCCGGTTGAACACCGTCACCTCATAGCCGTGCTTCTA
TTATCTCCACAGCACTCCAAACATCAGCAAGCAGCCCCTTTCCTCTCTGTTATTGCATCCAAACGCTGCACAACGTACCAGGATGTGGCCAACCATGCTG
GCGCCCATGACGCCCGTTCCAATCCATCCAACTCTAGGC