Description :
From Genome Similarity Track
Location :
contig_200:22344- 26409
Transcript NameFunction/comments
g14737.t1hypothetical protein

Sequence
4065 bases(100 bases per row)
GGACATGATGTGCAATTCAACTTTATCATGTTGGAAATTCAACTCACAATGAAATATCACGTTGAAGTTGTCAACGCGTACAGGTATACCAAAGTCTCTG
TGCAGGGGTTTTGGGTCTGTGTCGGGGTTACTGGGCAATGAGTCCATTAACGTTAACACATCAGTACGAGTGCTACAGAAGAAAAAATATCGAAGGCTTC
GTAAACTACGACAGCAGATACGACTCCCTGTCAGATGCCGAGGGTGAGGCTCACTTTGTGAATTCACCTTCTACCAACGCCGCTGAACAGGCAGGTATGT
TGTAGCGCTGCAACCCGATATTTGTGGTTGGCAATCGAGGCCGAGCGAAGCAAGGGCGACGGGCAGCAGTCACCCGCCCTAATGATCACCACTGTTGTAC
TTTCCTCTTCGAATCTGGAAGCTCGACTCGACGCGGGTTGCATCTTCAAGATGAACTTCAAGATGAAGGAGGCTGCGAATGAACCGGACTGAGCAGATTT
GGATGATCACCGTGCAGGTGACTTGGTTAACACTCTATATGTATGGATAGCTAGATTCGACTTCATGACTAGGCAGTGCTGAAGGTTTTCCTTGCTTTCC
TCACCAGGCTCCAAGCAAAAATCAATTCATTCTCACATTTACCTCCAAATCCTTAAGTCGCCTACTAACTCCAACACCAACAACTTCCTCTACTTGCCCA
CCAACTTTGTCCCCGCTCTGTTTCCAAGCTCCAACTCCATTGCACCCGGCAGGCCGAGCCCCAAGGAATTCAACAATTGGTAGCACTTGCTTCCGTCTGT
GGAGGATTAGGAGAAGTTTTCGTTGACGCCAAGAACCGGTGCCCATGTGCGAGCCGCCGCCCGCATATGTGAAGAAGAAGTAGGCCGCCATCGCACGTCT
CGCGGTGACCATGGTGGCGCAGCAAGAGGAGTTGAGTAATCTAGTAAGCACGTTCGCGAACAATCCACCCGAGAAGTGCCGAGTTGAAAGCATGCCCATG
CCGACATTCGGGGGCAAGAAGAGCGTATCCTTGGATCTGTTTCTCGACCGAGTCCTCATATATTTGGAGGCGAAGAACATTGATTATCACGCCGCCTACA
ACCAGCAATGAGTGGTGACAATGATGGCCTCTCACCTCAAAGAGCCTGCCGCGCCTCGAAGTCATCGCTGACTACCATGGATTCATTGGCCGAAGACCTT
CAGCATGAATTTGTACCTATCGATCTGCAAGAACGACTTCGAAGCGATCTTCAACAGCTATGTCAACGTAAATGTTCTGACCTCGACGACTACATTGCCC
AATTTCGACAATTGCTGTCGCAAATTTGGGCATCGTGGCTTGGACCAGGGCACCTGGTTCATTCAAAGCCTCGTGCAAAAAAACTCGGGAAGAAGTCGTT
TATCGTCGGTGCCAAACGGTGTCTGCAGCTATGACAATAGCTTAACAATATGAGCGATCTCACCCGAACAACTATCCTGATTGGAACGGCGAAAATAATC
GCTGGGCACAGCGTGAACGTATGCCGGTTCGCTCAGCACGACCTCGATTTCCCCCGCCGGATGATCAGTTTGAATCTGTGGAGATTGGACATGTCTAAGT
CTCGCGTGAGCAGTGTCGCCGTAATACTATTGCAAGCATACAGGACACATGCTTGGTTGTTGCCCAAAGAAGGACAGCAGTGCTTGTAACAGACGTGTCT
ACGTCTCGGAGATGAGTCCAATCCAGTCATGCGACGCTCAAATGGATGATGAAGAGCCCACCGCCAAGGTGATTCAGCTTGGGTCGGTATAGACAATGGT
GCTCATCATGAGAGGTTGCGACAAATTGACTTGTTTCGCAAGAATGCTGAAATCAACGGAAAAATTGCTCGTGTTTTGATTGATACACCAACTTGATCAG
ACCTGGTTATCTGTCAGGGCAGTTGGTTGCGCGCAAAGTCAATATCGAAGGATTCGATAGTGGCAGACTGTAAAACATTTCGGTACAAGAAGGTGCTTGT
ACAATCACATTGGACCTGCATCAATTTTCCGGCGTCCAATTCACGGAATTCGAGCTACCTACTAGTCACGACGTCATTCTGGGAAGCCTTGGTTAACGCA
ATTCAACCCTTACCTTGACTGGATTACACATCAAATCACTCTAGATCTCCCGTCAGCTATGCCGACCTCAATGTGCTGAATTTGTCCGCCGCATACAAGC
ATGAGCCGCTACCAGCACGTGACTGCAACTCTGCTATGTCATCTGCACTACCAGAACTCCCACCTCGGTCTCCGTTCGGGTTTGAGGCAATTCTGGATAT
AGAGCACGCGTTTTACATCAATGTTAAGGCGTTGCAGATGAAGCTAACATGACCTCGCTACGAGCAGTCATACTGAACGAGTTTCATGACGTAATACCCG
ACAACCATCCCGCTGGACTTCCTCCACAACGTGTCGTGGAGTTCGAAATAAATCTGAAGCCGAATGTCACGCCTCGGAATCGCCCACTAGTCCGACTATC
GAAAACAGAGCAGAGCGCACTCGACATTTTTATATCGAGCATGTTGGAAAAAGAGTATATCAAGCTGTCGAACTTACCTTGGGTCTCGAACGTGTGTGCA
GTTCCAAAGAAAACCCAGTTCTGGAAAGGCTCCGAAGAAGTCGTAATGGGTCAAAGCCGGCGATCCATCGTAGCCAATTCGCTGGGTTGTAGACTGCAGA
TTTCTCAATAACCAAACACTCGTGCCCAAGATCCCGATTCCGCACATCGATGAGTTATTTGATAGAATGAGTAGCGCAATATTTTCTTTCAACTCTTGAT
CTATCAGCTAGCATGGAAATCGACGCCCTTACTCCAGATGATGATGAATCAAAAACCAATCGCGCCTCTAAAAAAAAAGGTCAGTGTAGAAGAGTTGAAG
GACGACTTCGGTCCAAACCCCAGATCTTGCGGTGGTAAGCTAACTGTTCTGCGTGGCAAGAACCCGTTCAAATTGCCCTCACCCCGGAAGAAAACGTCGT
CTCACGCGCAGCGTCAGCGCTAAGAAACTGAGGGCATCGAGACTGAAACTCAAGGTGCTAAAACTCGAGGTGCTGAAAGAAGAGTGCCATGACGGTGTGT
CACTACGTCGCTGCAACCGGTGGGCTGCACACACATACAACGACCTGATATTGAGTGAGCTGTTTGCGTATTTTCCAGTCGTAATACGCGGGAGTTCAAA
AGAAACTTAGAACGGTGGTGACGGTGGTCGAGACACAAAAACCGGTGGTGAGTTTAGCAGTTGTATTCGACAACGAAATACGTGACTAGTGCAATATGGA
GCTCCAAAGCCGACGGTGCCGCCTAGTTGCGGACTCAGCTCAACATGCATCTGAGTTTGGTGCTTTATTTGGCGACGACTACTAATCAGAGTAAGTATTG
AGCGTGCTGATCAATAGTTTTGATTGATCGACTCTAACACCTACCCTCTACCCTCTGCATTGTTGTTGTCTAGGAACCTTGCAAAAGCCATGACAACATT
TCAGAGCCTACGCAATGCGTTGTATCACAAGCGCGACGTCATCACCTTCGTCGACAGAAAGTAGGCGGAGAATGAGTGTCAATATAGATCATTGTTGCCT
TATGGATAGTTGGATCAGGAAATATGGAAGCCGCCCTTCATTCAAGTTCGCTGGACGCAGGTGCGAGAATTAGCTTGCAGTTGAAGCCTGGTTCACAGAT
TTCTATCGCGGTTAGAGACATCTTACAAGTGCTACGGCTGACAAAGTAGTTTACCGATCGAACAATCTGCGCGACGCTTCAAACGTTTTACAATTTCAAT
CATGAAGCATATTTCTTGGACCCGCTGGTTGAAAAGGGAATGAAATGGGCAATACCAACCAACCAAGAGTGGAAGCTGGTCATTGCACCATGTAACATGA
ATAATATCCACTGAACGCTCGTGATTGCCGGCTTAGACAAGCATACGGTGGTTGTGTACGAGCCATTGATGCAGAGCTTTTACTTCGATCAGACTACACA
TTGGTGCAAGGGCGCCATATTTGATGCTATCTATCAATGGGAGCACAAAACCGGAAGGGATCACT