Description :
From Genome Similarity Track
Location :
Scaffold_23:223353- 224631
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06663Hypothetical protein

Sequence
1278 bases(100 bases per row)
TTGCGTATCACGCGCGCATTGACGCCGAGACCGAGGCGACGCTGGCGGCCATGAAGGCGCGCTGGGCCGTCACCGAGCTGCCGTGCGCGGACGCGGAGCT
CGACTCGCTCGTCGTTGGCGACCTCTTGCTGGCCTTGGACGACGACCTCGTACAAGTACAGGCGCTATTGCAGCGCACGTCGCAGCCGTCGCTCTACACT
TCGCTCTCGGTGTGGAGCGACGAGATCAACTACATTCAAGACACACTGGAGCTCTGGCTCTCAACGCAGACCGACTGGCTGCAGCTCGATCGCCTCTTTG
CGCTGCCCGACGTCCAGGCGAATGTTCGCCACGCGAACGTCGAGTTTCAAGCCGTGAGTCGCAAGTGGCGCGGCATGATGAAAGGCGTCCGGTCGACAAC
GTCGCTCCAGCAGTGCGTGCGCGAAGTCACGAACCGTACGCACCACTCTGCCACCATGCTACATGAACCGCAGTGGCTATGTACTAGGTGCGTTTCTGAG
CGAGACCAAGCAGCTCTTTGAGCGGCTTTGGAAGCAGCTCGCGAACTTTTTACAAGACAAACGACGCGCGTTTCCGCGGCTCAACTTTGTCTCAGACCGG
CAACTGCTGGCGATCATGGCGGCGACGACCGAGAGCCTTCGGGATCCGAGCGACGGGCACTGCCGCCACGTGAGCACCGTGCTTCGCATCTGCTTTGAGC
ACATACTGGAGGCAACGGTCAAAGTGCGGGCGACCCCCAATCAGAGCCTGCTCGGCAGTACATTGAGCGCCGACGATTTCCCGACCGGCCTCACGCCCGT
GGCCTCCGTGGGCTCTCTGGATATACCCGAGATCGAGCGCAACACCACAGACATTGTCTGCGTCGGCGGCAAGTACAACGAGGTGTTGACGCTCGAGAGC
CCGATCACCGTGACGCAGCGACCCGAACTCTGGATGCAGGATTTGCTAAAAGCACTGCATCAGTCGCTCCGGGACTGTGTCCGCGACGTCGCATCCGACG
ACGCGACGAACGCTGTGCTGCAGCTGTACATTGACGGCGACAACCGTGGTAGGCTCCGAGTCGATACAGACGTGGAGGCATCGTGGTGTTGTAGCCGACA
TGACGCGCGCGATCAAGCGCATGGAGCACGTCGTGGCCAAGTACCCGCTGCAAGTGCTTTTGCTGGCCTTTCGCATCTACTTTACCGGCGACTGCAGCCA
AGTGGTCGCGGGGCACGCTGCGTATACGATGGTGCGCCAGCAACAACTCTGCCGCGTACGACCATGGGATTGCAATTG