Description :
From Genome Similarity Track
Location :
Scaffold_323:2233- 5257
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.7Novel protein.

Sequence
3024 bases(100 bases per row)
GTGAGCATGGTTGCATCTCCAAACCACTCGAAAGTGTACATTGGGACGCGCGAAGGCAGCATCTTCGAGCTCAAGAGCATGGTCGCGCTCGACGACGACG
AGGAAGAGGAAAGCGAAGCTCCTCGCACGTCAAGTGGGGTGCGGTTGGCGGTGAGTGACGGTCATGCCGCCAACGACCACCTCGTGGTGCCCTGTGGCAG
CTACCCTGTCGGCGCCGTGTTTGCGAGTTCAGCGCTCACGCCATGTGGAGGCACGTTTGCGAACGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCG
CGAGCGGCGGTGTCAATGGCCGCTTGTACTTGTGGAGTATCATGAAATGCCGCCTCGTCGCTGAAGCGAGCGTGGCATTCGTGTTCGCGCACTCACCGTC
GGCGGTGCATGACAGCGTCCCGCTGTCCTNNNNNNNNNNTCTCGGCGTCATCGTCGGGGGATAGCCTTCCGAGCGTTGGCAGCCTCGAAGATGGGGCCAG
CGCGACCTCTGTGATCGTTACGGCACTCGCGTCTCGTGTCACGGACCCAGTCCTGATCGTAGGCGATCACACGGGACGCCTGCGTGCTATCTGCGTATCC
AAGATCGTTGGCGGCAGTGGTACCGTCGAGTTGATCCCACTGCACTCGCTGCAGCTTCTCGGTGGCGGGAACCCGTTGGACATCCTAGAGATGCACACGA
CGCAAGCCGTCGTTCTGGCAGCGTCCACGCGCGGCAACGCAGTGTTCCTGCTCTCGATGGACCATGAAAAGCACTTCCAGGTCATCGCGTACTTTACGCT
TTTGGAGCCCAACGAGCATGTCGTGGACGTGAAATGGAGCGTGCCGACGCACAACGCGAGCGCATTGATCGTCACGTGCTTCTCGTCCAGAGGGCTGTTC
TACGTCGCAAGGTACCAGCAGACAGCGACAACAGCAACGAGCTCCTCCTCTGATGCCGGCAACATTGGCGAAGCGCCGCAGCGACTGGCGCCAAAAGTAG
TCGCATTCGGTGAAGACATGCTCTCCAAGTGCGCGTCAATCACGTTTTTGAGCAATGCGCCCATGAGCATGATGCTCGCGATCGCGCCGCAGGGGAACCA
CCTGCACGTGATGAAGTACAAGGACATGGTGCTCGATCCGACCGAGAAGCTCTCGGTTCTGTCGAAGGTGCTCATGCAGGATGCCCACGAAAATGGCGTC
GCGACCATGGCGCTGTACCCTCGCACGCTGGCGGATGGTAGTGAGATGGTCGCGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCATCTACGTCAACCCCAGTGTCATCTGTGGCGATGGCGGGCAACGAGTGGCAGCTCGAAGACAT
TCAGGCCGCCAAGAAGAAAACGATCGTCGTGCACTCGGGCCCCTTGACGTCTCTGATGTTCGTGGACATCGAAGACGATTTGTACTTGGTCTCTACGGGC
AGCGACGGGTGCGTGTTCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATTGTGATGTTTGCCAAGTACAACGACGCGTTCAAGCCGGCGCAGGAGCTCGACGCCAAGCCGTTCCTACAGGCGCTG
GAGGAGCACGAGGAGTTNNNNNNNNNNNNNGTGCGCGCAATCGCTTCGATCGATTGAAGGACCAGACGCGCGCACAACTGAACGACCTGGAGATCAAGCT
CAAGGTCATGCTCAGCGATAACGACAAGCTGCCAGAGACAGAGCGGCTTCCGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTGGCGTG
ACCAGCTGGTCAAGAAAAATAAGGAGCGCGCCGACCGGGTCCGTGACGGCATCCTCAAGGACTTGGCCAAAATGAGCATCGTTCGCGAGCGCATGAAGCT
CGAGTTCTGGGACTCAGCCACCGTCCCGGGCGTTCGCTTGCGGGGGTTAAGTGCGTCTCCGTCGATGCTGCAGCAAGGGAATGGAAGTGGGAGCAACCCC
ACAAACGGTAACTTGTTCGTGTACAATTTCCCGATGCGACGGCAAAGCAAGCAAGAGCTTCTGTTGACCAAGAAGATTGAGCTCCTGCGCACGATCGAGT
TTGCACACCAGCAGCAAGAGCAAGAGGAGCAGGCCGCGATGACGATGACGGCAACGGCAATACCCCAGAAAGAGACTGCGTGGCGTCGATTCCGGGATGT
CGTGCTCGCGCCAAACGTGCAGTGGCTCATCGACGCGGGCATCCATCATCCGTCGTTGAACAAGTGGCTTCTAGATAAAGGCATAGGTTCAGGTGGCGCT
GCTCTCACGAAAGATAGGGACAAGAACGCCGAGATGCCTGTTCTGCCACTTCCTGCTTCCGTGAACGAACTCCAGAGCTACCACTTGGTGTACCACCCGG
CGGCAATCCGCACACGCAAGCAGCAGCGCATCCAGATCTGCTTGCTCAAGTCATTTGTGCGCTTCCTCGTCATGGCATTCAATGATGAGTTCAACGCGCT
TGTGACGCTCAAGGCGGCGAAATTGGACGAGATCGACGCGAAAAACGCGCGCATCGTCGAGATCTGCACCGACTTGGGCTTGCCCACGGTAGCACAGGAT
CTGTATCGGCCACAATGGAGTCCCGACGAGATCGCAGCGTCGATCCTTGACGTGAAGCCTGAGGAAATGACGCAACCAAAGTACGAAACTGAGGCCATGC
GCCGCCAGCGCGAGAAGGAGGCGGCCGAGAAGCTCGAGCTTGAGCGACAGCGCCAGAAGGACGATGTCGCGGGCCGAGCTCTCCAAGATATGATGGACGG
CACACTCGAGGTCAAGAAGGAGAACCTGGCGTCCCAGTNNNNNNNNNNNNNNNNNNNNNNNAGGAGCCGTGGATGCTCGAGATCCCGCTGGACGAGATGA
CCGCCGAGCAAAAGAAACTCGTTG