Description :
From Genome Similarity Track
Location :
Scaffold_104:22315- 25669
Sequence
3354 bases(100 bases per row)
CTCTATTGAGATGGTTCGTGGAACTAGGCGATGACATAAGGGCTGGTCATATCGTCGGTGAGGAAATGCAGATCGCATTTGCTCAATCGAACTTGGCAGG
GCGTGCAAAGACGTAGGCATTGGGCCTTAAGTTACACGACCCATTTGTCTTTGGGTCGTTGGAAGTCCTTAAGTCCCTGCTAAGGCAAACTTTTGAGCCG
CCGCGAACTGAGTTCAGGGCTCGTTCTGAACTCCTTAGAATCAAGCAAGGTGAACGTGACTTACACTCGTACATTCAGTACATACGTCACCTTACCAGTT
ACATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACGGATGGTCCTGTTAAAACCTACCTGTTCCGGTTGGAATT
CAACACCCTGGAAGAGGCGATAAGGGTTGCGGACAGGAGGACTTCAGCGTGAAACAGTCTCATGCAAATTTTAATTCCTATCGTCCGTCGAGACGACAAT
AAAATGGTGGCCCAGAACCAATGGACCTCTGTAACGCGGGGAGCGAAAGCTCTCGTGTTAACAACTACAAGAAATTGCAAAAATGCAATAGATGTCAGAA
GACAGAGCATTATGCATTCGAATGCAGTGCCCCGAGCTTGGTACCACGTACCGCAGGAAACAGTAACCGCCAAGCGGTCAAGAGAGGTCCAAGGCGTGGG
TCCGACGTTGGTGCAAAAACGCAACAACGTAACAGACAGCCAATAAACGTTCAGGGTCAGTAGGTGCGGAGCACCCTACTGATCCAGCAACGTCGAGTGA
GTTTGCAGGCCTCTTGACGAAAGTTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCCTGC
TACGTTCAACAGATGTGTTACGAATCGGTTGAGACCTGTGCGAGAATTCGCACCTAGCTATTCGACGACGTGTCGTCCATAGTCAGGCTATGGACGGACA
GACGGATTTGGAAGTCCACTGACTCCACGTCCGAAAGGTTCTTACACTGATGCGTGAGCATAAGCTGTATGCCAGCCTCAAGAAGTGTATATTTGCTGCA
AGTGAAATGCCATTTCTTGGTTGCATCGTGGGTAAGCACGGCGTCCGGCCTGATCCGGAAAAGATCAAGATGATCACTGACTGGCCGGTGCCTACCGACA
TAAAAGGACTTTGAGAGTTCCTTGGTCTAGTGGCGTATTTGCACAAATATTCGCACAATTACGCCGAGATGACTGTCCACCTCTCTCGTTTATTGAAGAA
GAACGAGAAGTGGGCATGGAGCGCTGATTTTCAGCGTTCATTCGAAGGTATCAAGAAAATCTTGATATGATCGCCGGTTTTGGCGATTTCAGACCAAGAC
AGACCCTTTCATGTGGTCTGCGATGCCAGTGATTTTGCCATCGGATGTGCACTAATGCAGTACGTCATAGACGGTGCTGATCGTGTCGTCTGCTATCAGT
CACGTCAGCTGCAACCAGCTGAACGTTACTACACAGTCCATGACAAGGAACTTCTTGCCATGAAGTATGATTTGTCAAAATTCAGGGTCTACCTACTAGG
TGATAGACCCTTCATCGTATACACGGACCATGCGTCCTTACGCACGGCAGTTAA