Description :
From Genome Similarity Track
Location :
Scaffold_299:22314- 27791
Transcript NameFunction/comments
Phyag_g4447hypothetical protein PHYSODRAFT_348671
Phyag_g4448hypothetical protein PHYSODRAFT_535258
Phyag_g4449hypothetical protein PHYSODRAFT_342845

Sequence
5477 bases(100 bases per row)
CGTCTGTTTGAGAGTGAGACGAACGATGTGTCCCGCGTGGAACTGGCGCATTTTTTCTTCGTGCTGGGCCACTCGGCAGTGAAAGTAGCCATTCACGTGG
AAAAACTGGCTGCGAAAGTGAAGAAAATGCGCGGTAATCGCAATGCCGCTGCAAGACCCGCTGATAATACGGCGTCGAgtggcgacgctgaagaTGTGAG
TGCAATGGAGGATGAACTTGGTGTGGCTGCTGAGGTTGAGGCGGAGGAAGACACTTTCGTGAACAACATCATTCAAAAGGAGATTGCCTGCCGCAATCTG
TTAGGTATGTATGGGCCACTTATTATCCGTGTGCTTGTGGGCAGTGAGGAAGAGTTCAAGAGCGATGAGCTATTGACAGAGTGTGCGGTGGTGGCACTGA
GCAAGTTCATGGCTGTATCGGAGGAGTTTTGCGAGAAGCACTTACAATTGTTGTTCACGATCCTCCAGGATTCCCCGCAACCTTCCGTGCGAGGTGACGT
GATCATCGCGCTGGGAGACCTCTCGTTCCGATTCCCAAACTTGGTCGAGCCATGGACATCGCATCTGTACAACCGACTCCGTGATGTAAACCTCAATGTC
CGCAAGAACACTATCGTAGTGCTTTCGCATCTTATTCTGAACGACATGATCAAGGTGAAAGGCCAAATTAGCGAGATTGCCATTTCGTTAGTTGATGGAA
ACGACGGCATCCGTAGTCTTgccaagctcttcttctttgagCTGTCGAAAAAAGGCAACAACCCCATCTACAACATGCTTCCAGACGCAATCGGCCAACT
GTCGACTAGGTAAGCTTCATAGTGGTCCATGTCAACTCTGCAACTCGTCGTTTATGTTTGACTAATGCGCTGTGCATTTCTGTAGCGAACTCGTATCAAA
TTCGGACTTCCAGACGATCACGCGATTCCTGATTCAGTTTATTACGAAGGAAAAACAAATTGAAAGCATTGTTGAGAAGTTGACGCAGCGGTTCCCGACG
GCATCtaaagcgcagcagcagcgtgatcTGGCTTATTGCTTGGCTCGGCTGCCACACACGGAGAAGTCGCTCAAGTATCTGTATCAGAACCGCAAGCTCT
ACAGCGATGCCCTCCATGACGGTGCGGTTGCTGATAACTTCACGTCACTGGTCGCGAAAGCACGGCGGGGGAACAACACGCTGGCAGCGACAGCTGAGAT
GAAGGAAGCCATCGACAAGCTGGATAAGTGTGTGgttgagaagaaggagggcaAGGAGGAGGTAAGTTGCCGTGATTATTTGTACGGTGGAGGCCACCAT
CTGATCTTTACTTCTTTTTCTTTAAAATGCTCGAACACTAGGACGAAATCATGGGCGGCGAATCCAAGGAACGCGTCTCGTCGCCGTTAGCCAAAGGCAA
GGCAAAGCGCAAGCTCTCCACCAAAGCTGCGAAAGCTACCCGAGCCACGTCAAAGAAGAGAGAGCGAGCCAAGCGAAAGACAACTCGAAAAAAAGCGACC
CGTGTCGTGAGTGAAGATTCCTCGGACGAAGAGTAAGTGATAAGAAAAGTCATGGACCCAATAATGAAAAGAATGTGTTTGTGGAGACAATGAGCTAAAC
TCCGACTTCAAGATATTTCCAACACAAAACTGGCccacgcagcgccgccgcagTTTCCAAAATGTTAACCATTGTTGTTAGCCTGAAAGAGGCTGCCGCT
CAATCGCCAGCAAGCTTGTGCAGGCTGTCAACACGCGTAGAACTTCGTCTGGGTCGTCCAGGTAATATTGCGCACGACTGACTTTCATGCCCACCGTGCA
CGTGTAACAGTTGCTACCCTGCACGACATCAAACATGTCCTCATCCGTTCGCTCGTCGCCTAGTGCAAGAATGAAGTCAAAGTCCAGGGCCGTAAAATAC
GGAGTCTCGCTTTCGTACTCCAGGATGCGGCTCACGGCACGGCCTTTGTTCACACGCCATGGTCGAATCATCACGTACTTCTTAATCCGACACATCACCA
CACCCACCGGCAGATCACGCAGCATCTGATCAAAATGGAGCTGCATGTCTTTAGCCTGCTTCAGTCCGAAGGTGGGGTCCGCGTCTCGAAAGTGCCAAGT
GTAGCAACAGTCCTTCACGTCCAGTAGTGAACCAGGAGTCCGCTCTGTAAAGTGCTCCAAAATGCTTTCCACTTCATCACGCCACTCCAGCTCAACATCA
CTGAACATGCATTGCCAGGGGGCTCTTTCAAAGACGGCACTCTCGCCGCTGCCGGCTCCCAtgactgaagaagaggaactggCCAAAGGGTCATCTTCAC
CACAGGCCATGAGAGGCAGCGATTCTGTAGCATGTAGCGGTTCGTCGCCAGTCATCCCTGTCAGTGCGTCACCATTGCCGACCAAACCGCAGCCACTTCC
ATCTACATCAAGTGTAGACGGGTGCCTGGAGGCTGGGCGGAACCAATAACCatgctctgcagcaagtcCCACGCGCGGTAAGTGACCAAACCATTCCTAT
TAAAGCAACGGCATTAGTGAGGCGGTGAGGCAGCATTAAATCTCACAGCAGGAACCGTACCTGCAAGCGGTTCTTGTTCCTTCCGCTGATGATATATACG
GTATTGTGGGGGTCGGCAGTCAGATCTTCGAGACACGAGAACAGAGCTGGGGAGGgctccgccagctcctccataCTCTGGTAATTCACAAGGGTGCCAT
CATAATCCAGCAGAAATAGTCGTCTCTGGCTTCGTTCGTAGTACCCGAGCAATTGCGCAGTGTCCAGCTTGTCCAATCGGTTGTATTCTTGCGCGGTAGC
AGCAGCCTGGGCAGTTGACACGCATCGTGGTGAATTGTTGTTCAGCAATGGCACGCATAGTGAAACGACCAACTAACCTCATTTAATGCCGACATGATTC
GTTGCGCCCACAGGGTCGACGTGTACGTGTTTACATAGCGCGACAACTGGTGATGACGAATGCGCTTTGTGGTTGTGCTCATGCGCAGCGCTGTATCCAC
GCtggcagcgacttgttcaATGTGCATTGGGTTCACCAACAGAGCACCTTGGAAGGACGATGCACACCTGCGTAGGTGCAGGAAAGATCTCCGTTAGCAC
CGCACACAAGTTACACAACCCCATCAGCGACAAGCGACGTACCCTGCAAATTCACTGTAGACAAGCACACCGTGACAGCTCTTCTTTTGAGCAGCAATGA
ATTCCATAGCCTGCAAATTGATCCCTTccttgatgctgctgacaaTGGCCACGTCCGCGCAGTTGTACAGCGCCACGAGCTGGTCGTGATCGATAGACTG
CTTCAGAAAGCGCACAGGGCAGTACTCGGCCGTCCCGAAGCGGCCATTCACACGACCAACGAGCTCGTTAATCTGGCGGCTGAGCATTCTATACTGGACA
GAGGCTGTACGTCCCACATCACGCACAACCGCGTAGAGCACCACTTTTCCTCGGTATTCGGGGTAGTGCTGAAGCAAGTACTCCATCGCTTCGAGCATCT
CGGGGATGCCCTTGCAAAAGTCCAGCTTGTGCACGCCCACGATGATCTTCATGCCGTCCTGCTGGCGCTTAAGCATCTCCACGTGAGCCTCTACCTTGGG
TGTCAGCGCGTACTTGGCTGGGTCGATTCCCATGGGACAGATGCCGAGTGAGATGAGACGTCCGTTGTACTCGACGCGACTGGGTGACGACTCGAGCCCG
AGCATGCGTGTGCAGACGTTGAGAAAGTGGCGCACGTAGTCGAAGTGGTTGAAGACGACCAGGTCGGCGCCCAGTACGCCGTGGAGCAGTGCCTCTCTCA
CTGGCAGCATCTGGAAGAACTCGGAGGACGGGAAGGGGCAGTGGAAGTAGAAGCCGCATGTGATCTCTGGGAACCGTCGACGTAGCAGTCCAGGAAGCGC
CATGAGTTGGTAGTCGCACACGAGCACCAGGTCTCCGTCCTTGTAGATCTCCGACACCGCCTCGAGGAACTTCTGGTTGGCTGAACAATAGGCGTCGTAT
TTCTCGCCAAAGTTCTCGAGCAGGCGACTGTCCGACCTCTGGGGCAGCGAGTGGAAGAGCGGCCAGAGCACCACGTTGCAGAACTGGTTGTGATACAGAT
CCAGCGTCTCGTGGTTGAGGAAAACCGGATGACAGGAAAAGTCCGTCTCCAGTCGCCGCCGCACGCCGTCCTGACTCGACTCGTCCACAGTCGCTCCAGG
CCACGAGACCCACCGCACTGCGTTGCCCCTTCCCAGGTAGTCGATGGCGCTCTTGAGTCCTGTGGAGGAGGCTGTGTACTGCCAACTGTCGCCTCGCTCC
GTCTTGACCATCCGCACGCAGCGGCGCATGGAGCACACGAGgattttgttgctgtcgttggccATGGGGATCGGCCCCAAGTTGCGCGCTAGGGACGAAT
AGCGCTGCGAGTCCTGACGCACAGCCGCCAGTCGACGGTGGAGATCATGCAGCTGGTCCAATAGAGAACTCTCGCCCAACTCCGTCAGACTTGGCGGTGG
AGGCTCCACGcccgaggacgacgtcggcggcggctccGCTAGCATGCTTTTCGTTCTCTATCTATCTGTACCAAAGGTTGGGTACCAGAATGatggtcaa
cttcaacttagGAGTGAACGTATTATTCATCAGTATGCAGCCAACCATGCAAAACATgcactctctctctctcctcgCTACAGTTCCTGTCCCCTTAGTG
CCCGTCCACGATCGCCAGTAGCAGGTCGCGGTACTCGCCGCTAGTGTCGCCGCGGATGCGCTTGCTCAGCTCCTTGCCGTACAGCTTCTTGTACGCAGTC
TTGACCTGCGGCAGCATCGCGTGGTAGCGCACCACCGCCGCGCTGAGCCCGTACTCGTCCGTGCCCAGGcccttcatcgtcttctccaacacgTCTGCCA
TGAGTTCGAACGGCTCGAAGACCATGCGGACGTGGTACAGAAGCGTCGACCGGATGTCGCTAGAGAACTCGGCCCTGATTGCCTTGATGATGTTCgactt
cttgtgcttcttcgtGTATTCAGCGTCGATGTTACGCAGGTGCTCAGCAGGACTCGAGACAATGATTCGGATAAATGTTTCTTCGTCAGTACCCCACTTC
CCCTCGCCAGCCTTGTACAAGGCATCCGCGTCCGCAACAGCCTTCGCACTCGTGTACACAGCGGGATCGAAGCTTGGCACGTCTCCCTTCACTGCCGCCA
TGACCGCCATCTTCAGGTCGCCACTCAGGTCGCCGCTCAAGACCTTCACCAGGTCCTCGCCGTACTTCTCTtggaacgtcttcttcagcagcgcgatCTC
AGCGTTCGAGCGAGCCATCACCACCGGGTAGATCCACTCCTCCGTCGTGCCCAGACCCTTCGTCGCCTTGCGCAGGATCTCGGCCTCCACGTGCTCCAGA
GGACTGGcgagcatctgcagcagaatgtCGTAGTcgctcgtgctcttcacccacgtcgtcaagctcTGCTTGTACAG