Description :
From Genome Similarity Track
Location :
Scaffold_26:22309- 24691
Transcript NameFunction/comments
Phymu_g1622myosin-like protein

Sequence
2382 bases(100 bases per row)
GATGGTGGTGGGCGCCAAGTGCTTCGTGCCGGACGAGACCCACGTGTGGCTCGCGGCCGAAGTCCTGCGCGACGAGAACTCGGGCGACGGCAAGACCCGC
AAGATCTACTgcaaggtggagctgcctgACGGCGAGACTGAAGAGCGCTGCGTGGATATGCTGTCCAAGAAGACtaaggcgctgctggacgtgcacCAGC
TGGAGTCGTTGCCCTATCagaacgagaacgtgggCCCTGAAGGTATTGAGGATATGATCACGCTCAACTACCTGCACGAAGCCGCCATTCTGTTCAATAT
CAAGAAGCGTTTCCTGTGCGAACTGccgtacacgtacacgggCGACATTTGCATCGCCATCAACCCGTACAAGTGGCTCCCGGATCTCTatgctgaagag
cagcaccTTCGCTACCTCAATCAGcccaaggaggagcttcCTCCGCACGTCTACGCCACGTCAGTGGCTGCTTACGACAATATGCGGCGCTCGGAACGCA
ACCAGTCCATCCTGGTTAGTGGGGAATCTGGTGCTGGTAAAACAGAGACCACGAAGATCCTCATGAACCACTTGGCTACCATTGCCGGTGGTCTGAACAA
CTCTACTATTAAGAGGATTATCGAAGTGAACCCACTACTCGAGTCCTTCGGTAATGCTAAGACCGTCCGTAACGACAACTCCAGTCGATTCGGAAAATTT
ACACAGCTGCAATTCGACGCGAATGGCACGCTCGTCGGCGCCAAGTGCCGCACATacctgctggagaagacccGTGTGATCCAGCATGAAGCACCTGAAC
GCAACTACCACATCTTCTACCAGCTGCTGGACTCCTCTGAGATTGCGcctgagctgcagctcgaccCTTCTAAGCACTACGTTTACACGGGTGACAACAC
GGCACAGAAGATTGAAGGCCTCTCAGACGAGAAACACTTCAACAAGACGCGCGAGGCGCTTGAGCTAGTGGGTCTGTCCCGCGACGATCAGAAACCGCTG
TTTGAGGTTCTGGCTGGTGTTCTTCACCTCGGTGAGGTGCAACTGCAGTCGGATCCGACTGATGACGAGAAGTCTCTCATCACCGAAGGCGACAGTGGTG
CGAACTCCGCGACACAGATGCTCGGCGTCACGTGGGAGGCGCTTCAAACCGCTCTCTGTTCGCGTACCATGCGTGCTGTGAACGACGTGTACAGCGTGCC
ATTGAAGAAGGATTTGGCTATGGACTGCCGTGATGCTCTTTCCAAGGCCATCTACTCGAACGTCTTCGACTGGCTTGTGGAAACGATCAATCAGTCGCTT
GCTGACGATGCTCATATGGCCAACCACGTCGGTGTCCTTGATATCTTCGGtttcgagcacttcaagcacaacTCGTTTGAGCAGTTCTGTATTAACTACG
CCAatgagaagctgcagcagaagttcacgcAGGATGTGTTCAAGACCGTGCAGATCGAGTACGAAGAGGAAGGTATCGTGTGGGACCACATTGAATACGC
TGATAACCAGGATGTGCTGTCCGTGATTGAGTCGCGCATGGGTATCATTTcgctgctgaacgaagaGGTGATGCGACCGAAGGGTAGCGAGGAGTCCTTC
ATGTCCAAGGTGACGTCCCTACACAAGGATGACATGGCACACGTCATTGAGTTCCCTCGTACGTCACGCACAGAATTCCTTATCAAGCATTATGCTGCTC
CTGTGATGTACGATTCGGTGGGTTTcctggagaagcacaaggaTTCGCTGCTGCCTGATCTGTCCGAACTCATGCGTGGTTCGTCTAAGCCGTTTATCGC
CAAGCTCTTCGAACCCAAGCCGGAGCccaaggctgctgctactgaggCGTCAGGCGGCCGCCGAAagcgtggtggtgctctgTCCATCACGACTGTCGGT
ACCCAGTTTAAGGAGAGTCTGACCGAGCTGATGGCTACTATCAACTCGACCCGTGTGCACTATGTGCGATGCATCAAGCCCAACCCGATCAAGAGTGCGA
CTGTCATGGATCAAAACATGGTGGTGTCCCAGTTGCGATGCGCTGGTGTGATCGAAGCTATTCGTATCTCTCGTGCAGCATACCCGAACCGATTGCAACA
CACGGAGATCCTGGATAAGTTCTGGCTGTTTGTGCCGAGTGGTGGCGAGTCTGCAGCAGACAAGTGCCAACTGCTCATggacaagctgaagctggaatCC
CCCACGCAGTACCAGATGGGTAAGACTCGCGTGTACTTCCAACTGGGTGTacttgaagagctcgaggacCGTCGTAAGAAGTTCCTGGATGCGAAGGCCA
CCTATCTGCAGAACGTTATGGTTGGCTTCACGCAGCGTATCAAATACCTCCGACAACTGGAAGCAATCATCAAGTTGCAGTC