Description :
From Genome Similarity Track
Location :
Scaffold_1:223070- 224750
Transcript NameFunction/comments
g65.t1XP_009515447.1 putative glycosyl transferase family 48 protein [Phytophthora sojae

Sequence
1680 bases(100 bases per row)
GTGGCTGCTGGCGTAGAAACGGTAGAGCTCGTCGAAAGACGAGTGCTTCGTCACGAAACCACGACCCGTCGCACGGTACTTAGCACCACCGGCAAGAATG
GTCTGTCCGAAGTAGAACCACTTCGTGCCGATGTGGAACAGGAAGTACAGCGGGCCACCCGTGACGAAGAGGACCACAATCTCGTTCAGTGCAGCCTTAA
AGCCGCGCTCGACAGAAATCGTTGCCAGCAGCGGTGCAGTCGTGAAGAACGCCACAGAGCCAAGCATCAGCTGCAAATTGCTCAGCAGTACAGGCTCGCG
ACCGCCAACACCCTCAAGTGAAAGCAAAGCGCGTAGCAGGTTGCAATACAACAGGATGTAAACGGTCCAGATGATGATTGACGTCGACAGGTAGAAGCCC
ACGTGGTTGTAGTAGAACGACAGCAGCTTGAAGAAGTCCAGTCGCTGACTAATGCGATACACATCACGCGAAAGCGACTGCTCCGCTGCACCTTGAGCCA
GCTTGGCCTCAAATTTGTAGATCTGCTGCATACCGACATCACGCCCCTTACCGACCTTCGTGTACTCCGGGAAGGTCACAGAACCCCCTCGCATACAATT
GTTGTAGCCCGCAAAGATATCTTCACTGAGGTTGATGCCCTTGCTGGCCTTGCTAATGCCGCCGCGCGTGATGAAGAAGAGCTTGTTAAACACATCAGGG
TGACCGTAATGCAGACGCATGCGCAGTGGCCGCGCCAGTGTACGCTGGCTCAGTGTCACGAAGGACGTCTCCTGCAGTGCCATGTAGTTAGCCAGCGAAC
TCACGCTACCCGTGAAAATGTGTTCTGGGATGCCCACGATTGTGAACGGCCGGTCAGCTGTGCCCTTGTCAAACTCTTCGAGGAGGTTTCTCATCTTGAG
CCCTTCCTCGAGGTATCCGTCTTGGTTCATATCAATTGTCTGCAAGTTTTCGCCACGAGTAAACACAATGGCCGAGTTCTGGTTCTCAGGCTTACCTTCA
CCCAAGATGGGGTTGCCTGGCAGCCGCACACGGTAGATCTCATGCACCGAGCCAAGCTCCTCGCCACCCTTGATGAGTACCGAGAAGTAAGACTGCTCTT
TCTGGTAGTTCACGCGCACCTCATCGATGTAAGCAACACGGAGGTTCGGAAAGCGGTGCAGCAAAAACTCGATGTCACTCGCCTTCGGGTCATTGTTCTT
CTTCTGGCGGCCATAAATCTGGCAAGCCACGACGTACGTAAACTTCGTGTTGATCAGTTCCTCCAATTTTTGCTGCGGCACCTGCTCAATCTCCGCAAGC
AGTCGAATGGCTGCTTCACCGTACATCATACCCTGAACCGTACGCGACAGCGTCTGGCCACGCAAGGAAGCCCACATACGCAGCTCAATAGCAGTCTCTG
GATCCTTCCAGATGTTCTTCTTCGGCTTCACTCGTTCCAGGAAGTTCTCCCAGTCTCGCTTGTACAGCGTTTGCAAGAACAGCAGAGTATGCACATCCAA
ACCATCCTGCTTACTTTCAAGATCCTTTCTTGAGTACAGCACGTCCTCGGCGTAGAACGGGGTCATGACGCTCCACGACTTCATTTCCTCGAGCAACGGC
GCCAACGGCATATCCATAAACATCGAGTTCACGAAGAACAGCAGACGGCGGCGCGCATCGTAAGACTGTGGCTCAGCATC