Description :
From Genome Similarity Track
Location :
contig_13:223027- 228467
Transcript NameFunction/comments
g2845.t1hypothetical protein
g2846.t1hypothetical protein

Sequence
5440 bases(100 bases per row)
TGTAAAGATTGCGAAGATTTGCAGCTCGCCCACTCTCCAGCAGGAGCTGATTCGCCAGTTTTGCAACAATATGGAGGGGTGGAACGACTTTGCTTCATCA
CTGGTCGCTTCACACTACCAGCATATGGACGCTCTGGATGATTCTCTGCTTGCGTTGCAAGTTATCTCAGGTGGACCGCGAAATGGAGCTCCGCGAAGGC
GAAACGCTAGCGAAGACGAGATTGATACCGGTTTCCCACTCGCTCGACCGTCCTCTTCTGCTAGCGAGTATCTGTCACGAGAGCTGGAGCCATTCAGACG
GTTGCCGATGGAGAAAGAAGGCTTCGGATCGTCACAAAACTTGGCTAGTGGAAACGAAGCAGTTCACCCGAGCGACATGTTCCAGAGCCGATCACAGAGT
AAATTCCCTGAATCCATTATCGATATTCTTCGGTCAGACGAATCTACATCGTTTAATGTGGAGGAAGACGACTTTTTTGTGAGTGGGTACGCGTACCAAA
AGCGTTCAAAGTGGATCAAGGTGCACCTAAAGTTTGAGAAGGCGACGTGCCAACTCACTCTGCAGGATGCCACAGATGCACCCTCTGGATCCCCGAGAAA
TGGTGGACAGAAAGCGACTTCTCCGTCCAAGGCGTCCATGCTAAAGCAATTTCTGATGGCACAGAAGCAAACCTGGACGTCTCGGCCCAAGAAGCTGGTT
GTATGCAATGCTCGAAAATGGATTGCATTCGGCCGTAGCTTAAAAAACCCGGATCGGGGTGCATTTGGCTTCCAAATTGAGGTGTTTGATGGCCACCGTG
AGGAAGACGAAACCTTGACTTTCGTCACGCGGCCAGACGCGACGAGGATGCGGTGGTTTGAGGCTATGCAGTGCGCTGTCACGAGAACAAGGACGTCGCG
GAACAGCTTCAGCGATATCGATGAAGCCGCTAATACGTCGCTGGTCGAGTGCGTTGCGAAGAACCGGGATGGTTCTTATCTGGTTGTTCCGGATATCAAC
TTGCTGGGACCGATGACCTCCGCGAGCTTCTTCATCAAGTCCGAGGTGCCCGAGGAAATGCCGTTCTGGGGAATCTATCATGGTGATCTGGGCATCAGCA
AGTACGCATCATTATTTAAGCAGTGCCTAGATGTGGTCTCCGTCGAAGAGAAGAGCATCCAGGCAATCGGCTACTCAGTGATTGTGGAGTTCGACGCTAC
CTTCCGCAGATCGGAAAATATCGCTGACTTCGATGACTCGGAGCCGCCTTCAGTCAAGTGCGCCTGTACGGACACGTACTTGGTCAGTGGCAATCAATCA
TTGGTTTGACGCGCACGATCGCTGACTCGGAGAAATTGCTGCAGCTCCTCTGTGATGATGAATAGAGCGACTCTGTTACTGAGTATTGTACATTGGCTTT
CAAGCTGTTCTATTCATTTGTAGTTTCGCGTGAGCCACGCAATGATTTCTCGGCGATCAAGTTGACCGTCGCTGCTGGTGTCGAGCTCGCGAAACACTTC
TTTGATCTGCTTGGCGGACAAAGCCATGCCGAGGTCGCCGCACAACCGTGCAAACTCGTCTTGGTCTATTTCGCCTGTGCCGTCGCGATCGATATCCTGG
AAAAACAGCTCGAACCGCTCTTCGTCGGTCTTGTCCGTGCCGTAGCGTTCCCGCAGCTCTTCGTAAATGCGGCTGAGGAAGGCTGGAGGCCCCCACGTTG
ACTCTCCTGTTGCGCTGTTCCAGTAGTACTGCACCACAAAGGTTTCACGCCTGGTTAGCAGCCAAGGGTGAACGGAAGGAGGCGCCAAAGCCGTCTTACC
GTGTTGCCGTTGCCGTCGTCGTAAGGCTTCCAGGCCTCCGATGGGTCCTGAGTGTTGTCACTCGACCTCACGTCGTGAGCACTGGGATGGATGTTATCTC
CGTCCGAGCCGAGGAACTTTGGCTTTTCCCACGTGGCTTCTCCTGTTCGAGAGTTGACGTAGTACGCGTATCCGCTGGCAGAGTCGACTTTCATTTCAAC
GAGCGAGTGCAGAAAGTTGCGGAATTTTGTGCGTTCGATGCGAGCTCGGTAAATGCGCTGCAGCTTGGTCGCAGCCGCGGCGCGTTCCGGTCCAGTCGCG
TTGCTCGCTGTACACTTGATCTGTGGGCGACCAGCGACGTGGTCAGCGTTTTCGTGCAACTTTTTCAGTGTCGAGTGAACCATAAACATCTCGGTCTCGG
TCATGTCGGCCATCCAGTGGATCATATTACCTGTACGCTCGTCACCTGTACGAAACCGTACTGTCGATATCGCTGTTCCGACTGATTCAGTTTTAAAGTG
AGTGATTTGGAACGAGTGTGCGTTGTTGTAAGGAAGCGCGTTTTCGATCCCAGTGCCGTCCACGTAGCAATACTTCAGATGAGGCATGGAATACATCTCC
AGCGGCAGGGAGCCACGCAAGCTTGGATTGTTGCGCAACTTCAGCGTCGTCAGGAAGCGCAGTTGAGTGATTTCTGCAGGGATCACCCCCGTCAGTCCAT
TCCCGGACAGGTCGATGGCCACGACATGGTTGCGCTCCCACTTCACGCCGAATACACCCGCAAAGTGCGATTGCATCGTGACTGTTTTCGGAATCGGCAT
CGCGCCATCCTGGAGAGCTGCTGCAACGCCCACGACTTTATCCCACCCAGTTTGTTGTGTCCATGTTGTTGCTCTTCCTGCACCGTTTGTCAATCGGCCC
CCAGTTGCTCGGAACAGTGATGCTAACGTCAAGAGCTCAAGTTGACTCGTAGACAAGTAGCCTTCGCTCGCATTCTTGTGGCGGCGGTGATGCTCGTTTT
GATCGGTCCCTGGAGGCATTCCAACCCTGCCCAACAATTGTATTTGCTCAAGCAAGAGGCCACGCAGGAAAGAAGACAAGAACACTCGTAAAAATAGGGA
ACGACATGTTGTTTCCACGCAAATAGACTGCATTGTAGGTGTTGCAGAGATTTGTTGTCGGTGCTTGCTACACTGCAGCAGACGAAGCTGGTTCGCTACT
TGTCTGCGCTTCGAGCGACAACTGCGTCAATCAAAAAGCACAACGTTAACATTTGCAAAGAGGAAGCGCTGAAAAATAGGCAGTTTACCTTTGCCTGTAG
ACGCTGGCGACGTCGCTCCAACGCGCGTTGGAGACGTTGAGCGTGGTCTCCACTCACAGCATCCTGTTGGTTGGCTCCTCGGAAGGCATCCACTGCAAGT
TGCTGGAGCTTTGGTGCTGCGTTTGACAGCGTAGTTGTTGCAGACTCGTCGGTGAAGACAGCGTCCTTATCGTCTCGGTACGCACAAAGCACCACAATCG
GGTTGTTGCCGCCTACACCATGGAAGAAATGAAGCCGATCAGTCCTTGTAAACCAGGCAGAGCACACACTGTGATAAGTCCTTACCATAAGAGCAGAGTG
CGGCCATGTGAGCCGTAGGTGACCAACTCACGTCCAGCACAGGACCACCGTGAAAGAAGTGGGTACCCCACACACTGCGCTGCAGTTGCTGGCCATGGAG
ACTGGTGAAGAGCCGAGGAACGCCGTCTTCAGACCCACTAATCACGAGCTTGCCATCGGGGCTGAACGTGCTCTTCACCAACAGCGATTCACAAGCCACC
CCGGCGTAGCTTTTGTTCAGCAAGAGATAGGATCGCAGCTCGTACTGGAAAATCGCGTTTGGTTGCGTGTGGACGAGCAAGTGAGCCTTCGAGGATGCAG
TTGGAGAGACGTGATGTTGCTTTGCCCCGTTGAATCGTCTTGATGAGTTTATAGTCGCAAATGCTCGACGCACTCGACGCACGGGCCCACACCGTGATAT
CCCCCTTTGCGTCACCACAGAAAACACGCTCAGACTTGGGGTCTACACGGATGCTGTGCACTGCAACAGAGCTGACACGAACTGTTCCGTATTCAGGTTG
GCCATTTGGAACCAATGACTCCTTTCGGAACCGCATGCAGCCATCCGAAGAGCCCGTGACGACGATATCCCCATTGCTACCTGGAAGAAAGATAGCGCAA
TACACGAAGCAAGGAAAGTGATGCCACTGGAATACCAGCGATAGCAATCGAGAGGCAGAAGCCGGTGGAGAAGCCTGGGGAATGGAGGCATTCATCAATG
GGAACTCCCATAGCCGAACAGTACCATCCGATGACGCTGAGAGCAGTCGAGACTGACCGTTCGAGGTATTTGTCCACTCCAAGGAGTAGATCACTCCTCT
ATGGCCTCGACCGACGGCAAACAGCTCTCCAGATGCCATTTGATACACTCGAACCACAAATTCTCCCAGTTCAGGGCTCACACTGGCAGCGAGATACCGA
CCGCACGGGCTGAAACTTATAGCAGAGCAACCCTTCTTTCCGGTCGGGAGTGAACACAGTACTCGTTGAGGAATCAAGCAGGGCTCAGAGGGGTTCCGTT
TGCAAGGGGCAATGAGATCGAACAGATCACTTGACGCAACGGCGGGAGGAGCCATTTTGCTTTCGATTTCACCAGCGTTTGGTGGTGGAGAAGCTTCTGT
AGGCGGCTCTTGGTTATCTCCAGCTCCGCTCTCTGGGTCAGTACTTGGGTTGTTCGCCTCTTGCTCATCGCTCGCAACGACATCGGCGCCAGCGGTGGTT
TCTCTTGTTTCAGGGACGCCAGTTTGTCGTGGAGAAGTGGCTGGGCTTACCGCTTTCAGTTGGACGTGCAGTGTAGTCGGAGCGGGGGCACGAGAGCGCT
TTTGGTACTGAAGGAACACGGCGGGCATAGTAGGGTGGTTTTTTCTCCAGCCCCATTGCAATCTCGCTTGGTAGCCGTCCATCCAGGTCACGACCTGGTA
CTCGAACAACCGCACACGCAATCCACAGACATCGACAATTGGCAGGGTTTTCGTCTTCGCACTCTCATTCGCATCTGGTACGTGTGGAAGCACGAATGAG
TTCATGGTTGGGGCGCCCTTGCTCGTAATGGCGTGAAAAAATCCCCACGCGATTCGGCGATACTCCGGTGCAGATGTAGCCCCAGGTGAATGACGATACT
CGTCGTCTTCGTCGTGGGTGCTGACAGACTCGAAGCGTTTGCCTCGACGGAAGCGCGTCCCTTTCGTGGCCGGCTTCGTCTCCAAGATTTCAAACAGCAG
CACTGTGCGGGGGTCCAACAAAGCAGGCATGTCAAGCGAAATACTCAGCGCTTGCTGCCATTCGAATGCATCTGAGGAGCAAAGTTGATGAGCAACAGAA
GACTAGAAGACACAAACTACCAAAACTTACTCGTGCAATCGTTGTTCGTGTCGGACGCAGCGCAGAACTTGGCTTCCGTTGTTATCTGTGCCGGACAGAG
AGCTCTTCCCGTGCATCGGTCCACGATATGAACGCGCACCTGAGGGTGAGAGTAGGCTCCAAACGGGAGCTCGTCGGAGCGTTCGATAGTCACTTCAAGC
TGACGTTGCGTTGGTGCAGCCTTTAGTGCAGTCAGACGCG