Description :
From Genome Similarity Track
Location :
Scaffold_5:2230207- 2272669
Transcript NameFunction/comments
Physo_506830Hypothetical protein
Physo_335007class II tRNA synthetase
Physo_510592predicted protein

Sequence
42462 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGGACGCGATTCCACGCCGTGATGAGGAACTGGTACGACTCGCTCAGACTGGCAAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGC
CGACCGCGTCGAGCTGTTCCGCCAGCGTCTTGAGCTTGTTAATGTGCTCCAGCACATCATCACCTTCGTCCATCGTTGTCGTGAAGAACCGTCGACGAAG
AAAGAGCTTGTTCGCCAGGCTCTTCTTCTCGAAGTGTCCCTCGAGTCTTGACCATGCATCATGCGCGTCCTTCGCCGACCGCACCAGCGGCAGCTGCGAG
TCCTCCAACGCGAGACAGACGATCGCCAGCGCCTTGCGCGACTTCTTGCGAAACGTCGCTTGGTCCGCCGCGGTCGTGCACTGCTCGAGCTTCACTTCCC
CACTCGTCACTTCCCACAGTTCGCGCTCCTCCAGCACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGGTTCCGTCGAACTTGTTGATGCGGGCGGT
CGCGGTCGGGGCGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGAAGAGCACTTGAGCAGTA
GTTGGCAAAATGCAAAGTGATTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTTACTGGATACACCCTACT
GGATTCTCTACTGGATACACAGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCTTGGCGTAATCACCGTGACGTAAT
CATCGTCCCGTAATCACCTGAATGATTTCGGTACCACACAGTGAAGGTCACGCCGACCTCACTGATGACGCGTTCGCGTCACACGGTCGCTTGGCGGGGC
GTCGTCACATCAGTCTTGACAACAGGCTCTCGGCATTCGTGGGACTTCGCATTGAGGGGGCGTATTGAGGGTTGCTGGTCTTGGGTACTGTGTACCAGTT
GTACCCATTAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGTTGATTATGGTGATTACGGTAAGTTGTTTACGCCACCGATGATTAGACGAGTAG
GATGATTGGATGAACACCGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGCGTGTCTATAACAGTAGGGTGTAAGCTCCAACAA
TTCAATCACTTTCGAATCTTCATTCTACCCCTCAAGTGCCTCCGCTCCGGTCCCGCCGTCTGCGACGTCCCTCCCTCCGCTTCTTCCGAGCTTCGTGTCC
AAGATCCATACCTTCCATCACCTACCAATAAAAACAACTCGGTGAAATCCGAGGACCCAAATCCGGGCACGCGCACCAGTCGTGACGAGGCTCGGTGAAA
GCCTGAACCGTCCAGGAGGTTTTTGTATAGCGGTAGCCCGGGCTTTGGTGTTGCAAAGCCTCCAGAGGGGGTGTCCCTGGAACCACAGTCCTTTGAAACC
GGAGTTCCTTGAAACCAAGTTTCAGGGATGGCGTGTCACCTTGTGAATCCCTATCGGCGTCGTTTGCCTTTGGGGAGCCTGGATCGATCACCAAGTGAGT
TGTTCAATACAAATAGGCAGTTAAACAGTTGAGCGTGACGTCCACTTGAACACACTACTCAATGGCGAGGGGACCGGAGGCGCAACGAGATGGGTAAACT
GGTAGGTCCACGAGGAAATCCCAGAATACACTCAGCTTCCGATAAACCAATACAATACAGAGTTATACACAACAAACAGCCGCCACTTATTCTTCGACCC
TTGGGCGGTGGGTCTTACACCAGTCGACTAGGCCGATTCCAGAGTACTGGTCAACTCTGGGGCCTTTCGCAACGCTCACCACCCTCTAACGAGGGAAATA
TACACAATCCAATATAATCCTCTCTCACAAATGCAGTCTCAAAGTCAAACACTCAGGGGACAACTGCTAATAAATCTCCCCAAGCTCAATTAGTAACATG
AAATGGGACACCACCCTTATCTACACGCAATGGGCCCAACTAGGATATGAAATGCGTGGATCACTTCAGACGCTCGAGCGAATGATCCCCACGCAGATGG
ACTTGATGATGGTGGGGAGCTCCGCGACGACCGTGTCCTTGGCGACCGACGGGCCCGATTCCTGGCTGGCAGTGACTCTCGACTTGCGCAGTAGTGGGTA
AAACGAACTCTCTGATTGTTTTCTGCTAGACTATCGCTAAGCTCAATGTAAAGGCTATCTTCTTCTGGGTTCTTCTGTGTTCTTCCGTGTTCCTTGCGTG
CGATCTTCGTGAATATCTTGACTTGAGTATGTTTGGGGGCGTTGTTTACGGCGACTTCGAAGTAGACTGGATTTTTCATCCCATCATCCCACTCTTCAGT
CAGTGACGTCTGGGTACAAATCAGGTCAGGCATCGTCGCTTGGTTTCAGGCTTGGATCCGAGGGTGCGTTTCAGGGATCCTTGATTCTGCAGCACTTGGG
TTCAGGTATCCGGTTCCAGGGGGCCAGCGGCTTGCACGAAGCGCGACTTGTGTTGCGAGGCTTGAGCTTGTTCCGGGTGCGCAAGGTAGTTTGTGGGTCT
TTATCGAAGCGAGGTGGGACGCCAGCTGCAATACGTTCGCAGGGGCGTTTTCGACATCCCGAGGGTCAATCCGCTTGAGGACGGGGGCGACTTGGACGCA
CCACTCGATTCCACGGATCCTCGTCCTGAAACGCGAGCTTCCAAGCCTGAAGGGCCCATCTCCGATCTCACCACACTCGTTCTGCGGAACACCGTCAACT
TCCGGCAAACACGTTGCCACGCAGGTACAGCCGGGTCTGAATCCATCAACCAGACCATCAGAGCGCAGTAATCTGCCATTCATGCGACTCACGCGGCTAC
TGGGAAAAATCCCGTTTAGCCTCGTGTCAATCGTCACACTCAAGTGAGATAGAATCCGGCTCAAGGCAGGTTTCAACGTTGGGGATGCAGTCTGGCTGTA
CATCCCAAAAGTGCAGCCGGGTCTGAGTCGCAAGTTGGCCCACTTGTGGCATGGCCCATTCAGGATCGCCGAAGTGGTTGGCGAGTTCCGAGTAAGGCTC
AAGGTCGAGGACACGGGCTACCGCGTAAACCCTTGGGTTCATATCAGCCGACTGAAACCCCGGGCGTTGTATCCCAGACGGCCTATAATCCAACCGGAGA
TCGAAGATGACGATGACACAGTACTCCCTCCCGAGGACAGTTAGGAAGCGGACAACGAGCATGACGAGTACGAAGTGGAGAAGATCATCGGACGTCCAAA
CGGGCACGAGAGTATCTCATCAAATGGAAGGGGTACGATGAGCCTGAATGGATACCGATGGCACAGCTGAATTGCGGAGCGCTCTTGTATGAGTTCAATC
AAGGGGCGAAAGCCCGAGCGCGGTTCCAAGCCATGCAGGCTGGGGACGACCACCCTAACATACAATAGTTGGGGGCGGCCAAGTCCGAATGGGGCAATCC
CAATTGGGAGTGTTGATCCCAGTTGGAGATTCCCAGGCGGAGACCCGAAATGCCTGGATGTGAATATGTGAATTACGGAAAAATTGATTGTGAATTTGTA
TGGAGCGGATCTACGATGGAGTTGTGACTACGGAGGGTAACCTGAGCGGAATCGTTTGGATACGCTGTACCATTGGCTACGACGGTTGCGTTTGACCAAT
CTAACCACGCATACACAGTTGCCTACAATGGACTATCTTCAGTAGTCCAACAAATTGGACCTATCAACTCGGCTTCCATGATTTACGGAGTTGGCATTAC
TTCTGGTTACATGAAGAATACTACATCCACTGGCTATCAATGGTACAACAGCTCTAAAAAGGAAGAGCACTTGAGCAGTAGTTGGCAAAATGCAAAGTGA
TTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTTACTGGATACACCCTACTGGATTCTCTACTGGATACAC
AGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCTTGGCGTAATCACCGTGACGTAATCATCGTCCCGTAATCACCTG
AATGATTTCGGTACCACACAGTGAAGGTCACGCCGACCTCTCTGATGACGCGTTCGCGTCACACAGTCGCTTGGCGAGGCGTCGTCACATCAGTCTTGAC
AACACTCCCACTCGACTCGTCAGCGACCACGATGCCCAGCTTCGTCCTGAGCGCGTCGAACTGCGGCGCCGCGATCGGCTTCGTCATGATGTCCGCCAGC
ATGTCGAGTGTCGAAACATACTGCAACACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGTGCTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGCACGCAGTATAAACCACACCCAATCATAGTTTCAATACTTTAGTTATTACTTCAAAGTAAGTA
AACACGTAGGTCACTACACTGTAGTAAGGCATGTCCGTGACAATGTAGCTCGCCTCGCAGAAACGGGTAATCAATAATACAGCGGCAACGATATTCAGCT
CATATTGAGGGTTGCTGGTCTTGGGTAGTTGTACCCATTAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGTTGATTATGGTGATTACGGTAAGT
TGTTTACGCCACCGATGATTAGACGAGTAGGATGATTGGATGAACACCGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGCGTG
TCTATAACAGTAGGGTGTAAGCTCCAACAATTCAATCACTTTCGAATCTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACGTCC
CTCCCTCCGCTTCGTCCGAGCTTCGTGTCCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCAAGACGCCTCGACCAAGG
TCTCCATTGACAAGTTCAACGGGGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGACGTGGCATGTCGTGAACCGCGA
GACGACGCCGAGCTTCACGGACTCGCGGGCCAAGGACGACTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTAC
CACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGACGCATCTACCTGAAGC
GCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGCAACGTCTTGCATCATTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAA
GATGGAGGATGAGGACGTGGCGATCTGCCTGTTGCGCAGCCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAACTACGA
TCGCAAGACGTCGTGAAGGTGCTGACGAATGAGACAAGGCGAGAAGACGGCGACGGTGAAGACGGAGAATGCGGCCAAGGCGTTCAACACCGACCGAGAG
TCTCGCCAGTGTACGTACTGCGGGAAATTGGGGCACACGATTGACAAATGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATG
GCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAGCTACAACTACGACTACGGCTATGATCGAGTGGCGTTCGCGGTCTC
ACTGGAGTGTGGCATTTCGACGGGCAAGAATGTGTCCGGGTTGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCT
CATTTGATTGAGCGGAATGAAGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGGACCATCGTGGAACGAGTGGTTCTGCCCA
ACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTCCCAAGCATGAGCAAGAATCTGCTTTCGGTGCCACAGATCAACAAGAGTGGTCTGTT
CCAAGTCGTGTTCGACAGCACCAAGATGCAGATTGCGCACAAGGGCTCCAAGCAAGTGGTGGCGACGGCAAACCTCGTGGATGGACTCTACTGGCTCCAG
ACGCCTCAGCGATCGGCGAATGCGGCGACCAGTGGGAAGACGGTCGACTTACACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGGTCG
ACAACAACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGCCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCC
AAGCAACCGTGACAAGCGTCACTACGACACGTTCGAGCTGCTCCACTTCGACGTGTGCGGCCCCATGGAAGAAGAGTCACTGGGTGGCAGCAAGTATCTG
CTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAGGACTGCATCAAGATGTACGTCACGAAGGTGC
AGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCCCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGA
GCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATTGGCCGCAGCATGCTGCATCACGCC
AAGCTGGACAAGAGCTTCTGGGCTGAGGCGGCCATGACAGCCATCTACTTGAAGAATCGTCTGCCATCACCCAAGATCGAACACAAGACTCCGTTCGAGA
TCGTTTACAAGTCCAAGCCGAGTGTGAAGCACATGCGTGTGTTCGGATACCAGACGTACATCCTGACGCCGAAGGAAAGACGGCGCAAGTGGGACCCCAA
GGCTCGCGCCGGGCTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGAGTTTATGACATCGAGGCGGGGCAGGTGGTTATCAGTCGCGATGTCAAC
TTCAATGAGTCGACCTTTGGACTTTCGACGCATACTTCGGATGAAGACGTCGATGATGCTGTGTTGGACTTGGACGCGCTGGACCTGGACGACAACGATG
GACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGTACCGACCGAGTGGCGACGACAACACTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGC
TGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCCTCGCGCCGAGCCGACCCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGACGACGACTCG
ACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGGTCCTGATC
AAGTGCACTGGCGCAAAGCGATCCGCGCGGAGCTCTAGTCGATGCGACTGCGTGGTGTTTTTCGAGCTGCCAAGTTGCCTAACGGACAACGCGCCATCGA
TACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATT
GACTACACCGAGACGTTCTCGCCCGTGGTCAAGTATGTGACGCTGCGCATGGTGATCGCGATTGCTAAGTATTTTGGCTGGCCCCTCGACCAACTCGACG
TGGTGACAGCATTCCTGTACGGGATAATGAAGGAGGTGGTCTTCTGCGTGGTTCCGGAAGGCGTCGAACTGGATGGTGACTTCGACTGCCTGGAACTGGT
GAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGAGTGTGGAACGAGACCTTCGACGAGTTCGTGTGCTCCATCGGCTTCCAAGTGTCGGCCTTCGATCCG
TGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTTGTACTGGTGTACGTGGATGACGTACTGATTACCGGGAGTTCGCCCGAGCTGATCGCACGCA
CGAAGACCGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGTTGGTGGACGGCCCGGACGGCAGCGTGAC
CATGTGCCAGCGGCGATACGTGGACGACATCCTGAAGCGCTTCGCCATGGACGAGTGCAAGGCCGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTT
CCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCTCTGATGCACTTGATGACCGCCACGCGCCCAGACATCGCGTACGCCG
TTGGCTATGTATCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGTATCTTTCGCTACCTGCAAGGCACCAAAACGCATGGGAT
CTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGATGCGGACTGGGCCGGCGACCTCGCCGACCGCAAGTCCACTTCAGGCTACACGTTC
ATGCTCATGAGTACGCCTGTGAGCTGGGGAAGCAAGAAGCAATGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAAGTGGATTCATCGC
CTGCTATGCGAGATTCTGGCGGCCGCTAATGAGACTGGACCCGAACTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACGAAGAACCCAGTGA
ACCACGGTCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGATGAAGTCAAGCGCGGCGAAGTCAAGCTCCAGTACTGCGAGACTTCTGTGAT
GCTAGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGATCTGACGGTGGCTCTCGGCATTCGTGGGACTTCGCATTGAGGGGGCGTATTG
AGGGTTGCTGGTCTTGGGTACTGTGTACCAGTTGTACCCATTAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGTTGATTATGGTGATTACGGTA
AGTTGTTTACGCCACCGATGATTAGACGAGTAGGATGATTGGATGAACACCGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGC
GTGTCTATAACAGTAGGGTGTAAGCTCCAACAATTCAATCACTTTCGAATCTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACG
TCCCTCCCTCCGCTTCGTCCGAGCTTCGTGTCCAAGATCCATACCTTCCATCAATCATCGAGGCCAGATTTTACCGCCCAGTAGAGCTGCTTCCTATCCT
GCACGCTCCTGTCGTGCGAGAGCGAATTAGTATCGTGGAGATGCTGCTTGACACCATAGAACAAGATGAGTACAAGCAAATATTGCGGGATGAGCTGAGT
AGAGGCCAACTTGGTGGAGTGGAAAGAACTTACGCGCAAAAGTTCTTCAATGAACCGGATATTGCTGGACGCATGATGATGGTGCATTTGCATTCGGCAA
GCGAATGGTTTATACAGTGGATGGCTCTTCGTGTTCGAGACACCTGATGGAAGGTATGGATCTTGGACACGAAGCTCGGACGAAGCGGAGGGAGGGACGT
CGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAATGAAGATTCGAAAGTGATTGAATTGTTGGAGCTTACACCCTACTGTTATAGACACGCG
ACCCTGCGTTCTATCACCTAGTGCATCTAATCAACCATCACTCACCGGTGTTCATCCAATCATCCTACTCGTCTAATCATCGGTGGCGTAAACAACTTAC
CGTAATCACCATAATCAACGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATGGGTACAACTGGTACACAGTACCCAAGACCAGCAACCCTCAA
TACGCCCCCTCAATGCGAAGTCCCACGAATGCCGAGAGCCACCGTCAGATCCGTGTGGCGTGGTCCCGCAAGCGCCTTCGTCATGATGTCCGCTAGCATC
ACAGAAGTCTCGCAGTACTGGAGCTTGACTTCGCCGCGCTTGACTTCATCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGACCGTGGTTCA
CTGGGTTCTTCGTCATCTTGATGCACGACTGGTTGTCTTCGCGGATCATGAGTTCGGGTCCAGTCTCATTAGCGGCCGCCAGAATCTCGCATAGCAGGCG
ATAAATCCACTTGCCTTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCATTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATGAGCATGAA
CGTGTAGCCTGAAGTGGACTTGCGGTCGGCGAGGTCGCCGGCCCAGTCCGCATCCGAGTAGCCACGAAAGTCGATCTTGTCGCCCGGCTTGAAGCAGATC
CCATGCGTTTTGGTGCCTTGCAGGTAGCGAAAGATACGCTTGACCGCAACCCAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGCGATACATAGCCAACGG
CGTACGCGATGTCTGGGCGCGTGGCGGTCATCAAGTGCATCAGAGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAAC
CAGTCGAGTGCTCATGTCCACCGGACTCACCACGGCCTTGCACTCGTCCATGGCGAAGCGCTTCAGGATGTCGTCCACGTATCGCCGCTGGCACATGGTC
ACGCTGCCGTCCGGGCCGTCCACCAACTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCGGTCTTCGTGC
GTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGTACGTCATCCACGTGCACCAGTACAAGCACGCAGTGACCGTCCACCACCTTGATGTAGAGGCACGG
ATCGAAGGCCGACACTTGGAAGCCGATGGAGCACACGAACTCGTCGAAGGTCTCGTTCCACACTCGCGAAGCTTGCTTGAGACCGTAGATGGCCTTCACC
AGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTCCGGAACCACGCAGAAGACCACCTCCTTCATTATCCCGTACAGGAATGCTGTCACCACGT
CGAGTTGGTCGAGGGGCCAGCCAAAATACTTAGCAATCGCGATCACCATGCGCAGCGTCACATACTTGACCACGGGCGAGAACGTCTCGGTGTAGTCAAT
GCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTATCG
ATGGCGCGTTATCCGTTAGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCTTTGCGCCAGTGCACTTGAT
CAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGA
GTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCGGGGTCGGCTCGGCGCGAGGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCT
CGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTTGTCGTCGCCACTCGGTCGGTACTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCAT
CGTTGTCGTCCAGGTCCAGCGCGTCCAAGTCCAGCACAGCATCATCGACGTCTTCATCCGAAGTATGCGTCGAAAGTCCAAAGGTCGACTCATCGAAGTT
GACATCGCGACTGATAACCACCTGCCCCGCCTCGATGTCATAAACTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAGCCCGGCGCGAGCCTTG
GGGTCCCACTTGCGCCGTCTTTCCTTCGGCGTCAGTATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTCGGCTTGGACTTGTAAACGATCT
CGAACGGAGTCTTGTGTTCGATCTTGGGTGATGGCAGACGATTCTTCACGTAGATGGCTGTCATGGCCGCCTCAGCCCAGAAGCTCTTGTCCAGCTTGGC
GTGATGCAGCATGCTGCGGCCAATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCG
ATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGGGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCA
CCTTCGTGACGTACATCTTGATGCAGTCCTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAG
ATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCACACGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGTGACGCTTGTCACGGTTGCTTGGG
AACGGTTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTTGTTGTCGA
CCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGTAAGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTG
GAGCCAGTAGAGTCCATCCACGAGGTTTGCCGTCGCCACCACTTGCTTGGAGCCCTTGTGCGCAATCTGCATCTTGGTGCTGTCGAACACGACTTGGAAC
AGACCACTCTTGTTGATCTGTGGCACCGAAAGCAGATTCTTGCTCATGCTTGGGACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGG
GCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCTTCATTCCGCTCAATCAAATGAGC
GAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACAACCCGGACACATTCTTGCCCGTCGAAATGCCACACTCCAGTGAG
ACCGCGAACGCCACTCGATCATAGCCGTAGTCGTAGTTGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGCCATTGCCAT
TGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCAATCGTGTGCCCCAATTTCCCGCAGTACGTACACTGGCGAGACTC
TCGGTCGGTGTTGAACGCCTTGGCCGCATTCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGTCTCTTGATGTGCTCATTCGTCAGCACCTTCACGACG
TCTTGCGATCGTAGTTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGGAGGCTGCGCAACAGGCAGATCGCCACGTCCTCAT
CCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAATGATGCAAGACGTTGCCGCCTTCCGACATCTCCATGCTGAA
GAGTTGGCGCTTCAGGTAGATGCGTCCAGCCTTCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCACGCAACCCACGCTTCCTCGCAGTCGTCGACC
ACATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTAGTCGTCCTTGGCCCGCGAGTCCGTGAAGCTCG
GCGTCGTCTCGCGGTTCACGACATGCCACGTCGACTTGGTCAGGAACACGCCACGCAAGTAGCGGTTCCACGTCGCGTAGTTGTCCCCGTTGAACTTGTC
AATGGAGACCTTGGTCGAGGCGTCTTCGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGGATCTTGGACACGAAGCTCGGACGAAGC
GGAGGGAGGGACGTCGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAATGAAGATTCGAAAGTGATTGAATTGTTGGAGCTTACACCCTACT
GTTATAGACACGCGACCCTGCGTCCTATCACCTAGTGCATCTAATCAACCATCACTCACCGGTGTTCATCCAATCATCCTACTCGTCTAATCATCGGTGG
CGTAAACAACTTACCGTAATCACCATAATCAACGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATGGGTACAACTGGTACACAGTACCCAAGA
CCAGCAACCCTCAATACCGCCCTCATCCCATTGTTCCACTCATTTTTGATTTGGCATGGCCTTCCACGTCGAAGCCTTCCAGCACTTCCTGGAGCTGCGC
GAAAAAGCGCAAGCATGGCGGGAGTTTGAGACGCAGCTGAGCACACTTGAGCCCCGTGATGAAGCGTTCGTACGCGAGATGCTGATGCGGCCAGCCGTGT
CGCAATGCATCGATCGTGGCTACGAGAGAAGCCTTTACGATGCATACGTCGAAGGCAGAGCAAGAGTTCAAGCAGGCCTTGTGCTGGTCGGTTCGCCCCC
TTCAGATCAAGAAGAGCACTAGTTCCAGACGCCGCCAGCAAGCCCGTACAATGCGCAAGATTCATCGACACCGCTTCCAGAAGCGCGTATACCGCTCAGC
TACGCGGAACTCTGCGCACTGACGCCACCCGCCTCGCCTGCCATCCACTACCACAATTGGATCCCATCATCGTCCGTGGCGTGGTCGCCAAAATCACCGA
CGCCTTCGCAGATGGATGAACTGGATCAGGTGATGCAACAAACGCGCGAGAGGGAGAAAAAAGATACACGTACCAGGAAGCGCAAGCGCCACCAGCCATA
TATTCTGGTGAGGCGCTAAAGATGAGGCCCACGGATCCGCCAAGAACCCGTTCTAGCAAGGATACATTTTGATTGGTTAATGTCAATATATCCAGTCCGA
TTCTAGCCAGTTGAATTGCATAGTGTCACGTCTCAGGCACGCCAGAGGTGACACGTGTACGTTCATATGGAAGAAACCGCGGCGGTAGCACATTGGCTTT
GTAACCACCAACTATGTTGCCCGGAGGGTTGAAGCTATTCTGGGATCTGGATCGTATGCATATCCAATCCCATACTGAGTAGTATCGCGCCAACAAAGTT
GCGTAAAATGTTTTGTATTTGGGGAAGGGCCATCGGAACTGAAATCATACTCGTAGCCTTCTGAATACCAGGCATCGATTGTTTTCTTTATGATTTTACA
TGGGTCGTTTTGGTATCCTTTAAGGAATCCTAAATTCTCACCGTACAGAGGGGTTTCCAGAATGTTTGAAGTCTTTTGTCCTAATCAAAGGTGGCTGCAT
AGTTCTGTGGAAATGCAGCGATGTGTTTGTTATAATTAAGAGTCTTCGTATTGTGTCGCGTTCGATGCAGATTGATATAATGAGTGGCATTTACTAATTG
CACATGATTAAGCTCGCACGTTTGTGGCATTATCGATCTATATTTATACGATCATTATATCTTACAAAAGACGCCTCACTAATCAAAACAACATGAATAC
GCACTGATCTAAAATTTTCACCAAATGCAATGAAAGATTATATGCATGTACAATGCCAGCCAAATGTTTATTGCAATCCGCAAGAGCTTGTATTATCTCA
CGATCAATTGCGTCCATATCGCGTATCAATATCCGATGATACTGGCTGCTTGGGGGATACGCCTGAACTTTATCAAGATAACGACGATGCGTATAGAATA
ACCATGTTAGGCGAGTAAAGGTTTTGTATCTACCTTGTTATTGTTGTCAAGACTGATGTGACGACGCCTCGCCAAGCGACCGTGTGACGCGAACGCGTCA
TCAGTGAAGTCGGCGTGACCTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCACCG
ACGTGGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGC
ACGCGGTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAACTACTGCTCAAGTGTTCTTCCTTTTAAAATGTTTTGTATTTGGGGAAGGG
CCATCGGAACTGAAATCATACTTGTAGACTTCTGAATACCAGGCATCGATTGTTTTCTTTATGATTTTACATGGGTCGTTTTTGTATCCTTTAAAGAATC
CTAAATTCTCACCGTACAGAGGGGTTTCCAGAATGTTTGAAGTCTTTTGTCCTAATCAAAGGTGGCTGCATAGTTCTGTGGAAATGCAGCGATGTGTTTG
TTATAATTAAGAGTCTTCGTATTGTGTCGCGTTCGATGCAGATTGATATAATGAGTGGCATTTACTAATTGCACATGATTAAGCTCGCACGTTTGTGGCA
TTATCGATCTATATTTATACGATCATTATATCTTACAAAAGACGCCTCACTAATCAAAACAACATGAATACGCACTGATCTAAAATTTTCACCAAATGCA
ATGAAAGATTATATGCATGTACAATGCCAGCCAAATGTTTATTGCAATCCGCAAGAGCTTGTATTATCTCACGATCAATTGCGTCCATATCGCGTATCAA
TATCCGATGATACTGGCTGCTTGGGGGATACGCCTGAACTTTATCAAGATAACGACGATGCGTATAGAATAACCATGTTAGGCGAGTAAAGGTTTTGTAT
CTACCTTGTTATTGTTGTCAAGACTGATGTGACGACGCCTCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAAGTCGGCGTGACCTTCACTGTG
TTGTACCGCAATCCTTCAGGTGATTACGGGACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCACCGACGTGGCGTTCTCTGATTGGATAAGGTAA
CTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGCGGTTGCGAACTAAGGACCTGAATCG
AATCACTTTGCATTTTGCCAACTACTGCTCAAGTGTTCTTCCTTTTAAAATGTTTTGTATTTGGGGAAGGGCCATCGGAACTGAAATCATACTTGTAGAC
TTCTGAATACCAGGCATCGATTGTTTTCTTTATGATTTTACATGGGTCGTTTTGGTATCCTTTAAGGAATCCTAAATTCTCACCGTACAGAGGGGTTTCC
AGAATGTTTGAAGTCTTTTGTCCTAATCAAAGGTGGCTGCATAGTTCTGTGGAAATGCAGCGATGTGTTTGTTATAATTAAGAGTCTTCGTATTGTGTCG
CGTTCGATGCAGATTGATATAATGAGTGGCATTTACTAATTGCACATGATTAAGCTCGCACGTTTGTGGCATTATCGATCTATATTTATACGATCATTAT
ATCTTACAAAAGACGCCTCACAAATCAAAACAACATGGATACGCACTGATCTAAAATTTTCACCAAATGCAATGAAAGATTATATGCATGTACAATGCCA
GCCAAATGTTTATTGCAATCCGCAAGAGCTTGTATTATCTCACGATCAATTGCTTCCATATCGCGTATCAATATCCGATGATACTGGCTGCTTGGGGGAT
ACGCCTGAACTTTATCAAGATAACGACGATGCGTATAGAATAACCATGTTAGGCGAGTAAAGGTTTTGTATCTACCTTGTTATTGTTGTCAAGACTGATG
TGACGACGCCTCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAAGTCGGCGTGACC