Description :
From Genome Similarity Track
Location :
Scaffold_1623:2230- 3879
Sequence
1649 bases(100 bases per row)
CGAGATGGCTTGATGACTAGGCCGTTTGCAGGCTCCTACGCGGACTGACATGAAGCAAGTAcagtatacatgtatacatgcGCATGTAGATGCAACATCT
GGCTAGGCACAAGTGAATATGGTGCGATTGGAATCCCTAGCGAAGACAAAACTGCCTTGCCCTGAAAATGAAGTCGGAGGGCACGCACCGCATGAGAGAA
TTGCACACCTGTAGATGTTTCACGAAATTAAAAGCTGTTCCTCGCATTGCATTGCAACCTCAATCCACGACAAGACAGTCAAGGTTTCAGAGGTGGGATT
TCGGAAGGATACGTGCTGTGCTTCAGGAACGACGAACATTCAAATACCCCTTCCCGATGTACATGCAGAAGTTTGAAGCAATGAGGAATCGACAAGAGAA
TTATCCGACGACGCCTCCATCCATTGCACGTCACCAATGCAGTGCAAGGAAGATAAATGGCTAAGCAGACAAGCAAGAGATCTATCCGATTCGGAAAATC
TTTGCTTGTCGGATTCCGACGGCGCATGGGCGACAATGACAACGCGGGCAGACTACACTACCGGTATCGAACCCTGCCGTCGGAAAGATCACCCTTCTAT
TAGGATTTGAACGGTTCTCCTTTTGACTAGCGATTTGTAAGACAGGTCTTCTATTCAGATGACAAAAGACGCCGTCGGACAAAATGCTACGTCGGTCGCG
TCTCCTTGCGCGCACAACTCAGCGGCGGGCAGCGATGAGTTTGTTAAACAAGGTCATCAACTGCAATCGAATGGCTGAGAAGCGACTTCGATGGCCAAGC
ACTTAACGAAAAGACCTCGTTTAACTCAAGTGAAGGCAACAAAAAGCCCGGTCCTATCTATTGGCCGCGTGCATATGAGAGATCATACGACGTTATCGCT
TCCCTTCCAAGGTCTCGTTTCCTTCCCGAAGAGCGGATTGTGAGTCAACCATGAAGGCAACGGCGGTAGACTCTACCGCCGCTCGCTCTACCCGGTAGAG
CGAGCCCCAGCCATTGATCCGTGTCGCAGGTGCCATTTCAACCACGCTATCCGACGGCGACACCCTCATCGACAACAGCTCGTCCAAATTGACGATGCGA
ACATCGTTGATCTGCAAATATTGCTGGCTGTGCAGTGTGCTGGATCTGAATCTGGCCGTGCATAAGGAGGCCAAACCATGATGTCGCCACGCAGACACAT
TGCAGTCGTCAGCAAGCTCAACGAGCGTGCGCGGCCACAGACCGAGAGGAAGCCTGCGACAGCGCTGGCTAAGGTGTCCGTCGTCCGTGCTGCATGTACA
ATGCACAGCTAGCGGTTTTCGCTAGCCTGCTCCCCCCTGTCCGTGACATTCGTCGACAGTTCGTGTTAGCGCCAGCTGGGGCGACACCACGTGCCATTGG
CCCGAGGCACGAACTCGCGCGTAGGCTCCTGAGAAGCAGGTCTGCATCTTATGGTTGTCATTCTGTTCGAACTGCTGTTGCGGCCCAAAGACTGGGCGAG
ATTAATTTGCCGCTCGAGGCTTGCAATTGTACGCTTACCACAGCGCCTCCATAGCCAATAATCGCTGCAAGAGGGAAAGCAGTTTGAACATGCAAACAAA
GATGTGCCCTAgtggagctcaagcacaTCGCGAAGATTGCTGTGCTACT