Description :
From Genome Similarity Track
Location :
Scaffold_455:223- 3952
Sequence
3729 bases(100 bases per row)
TGCATAGCCTGGAAACGGGCCCGCGCTCTTGCGCCTTGATTGAATTCGTAGAGCAGGGCACCACAGTTGAGCTTCGACACAGGCAGCCACTCGGTCTCAT
CATACCCCTTCCACTTCACAAGGTACTCACGAATTCGTCTCGCTGTCCGAGTCCGTTTAGTCCATCGCAAATCCAGGATTCGCTCAACTTCGTACTGATT
GTTCGCAGCGTCGGGCTCCCAACTGTCTTCAGGCAACAGCGCCGCATCAAAGTCATCATCCTCGTCCACGTCGATCTCCACAGTGGGCCGCTTCGGGAAT
AGTGCTCTGGGTTTCAAACGGCTCACGTGTACCCAGGGATTCACGCGATATCCTGTATTCTCGACCCTGAGTTTCACGCGGAAGTTGTCATAGATTTCCT
GAATTCTGAAGGGGCCATGCCACATGTGAGCCAGTTTGCGGCTCAGCCCGGGCTGCACTGTGGGTATATACAGCCACGCAGCATCACCGGCTGCGAATCC
TCCCTTCAGTCGTTCGGACAGCTCTCTCCACTTCCTGGTTTGTTCGGCAGAGCGCGCGCGCTTGGCCTTCCTCTGAAGATCCTCAGCGCAAGCTTGTGCA
TAACTATAGTCACGCTGTAGCTTCCTGCGCCACTCGTACGCAGTGCGCTCCTGGATACTCGAGGGCCTGGGTCCTACATTGCAGACACCGTGTCGTGTGC
GTCCCAGCTGTGCACCGAAAAAAACGGAGTGTCCCAGCAAGTGGCATCAAACGATGGTATCACGGCAAACATCAGGCGCTCAGCATGGTCGTCTCAGTCA
CCTCTGGCCGCCTTCACAATGTACGCTCGAATGCTGCGCACGACAGTCTGCACCGACCGCTCCTGTTGTCCGTTCGCCTGGGGGCGATACGCCAGAGTGG
CTCGCTGCTTGCTACCCAAAAGTTCACGGAAACGCGTGAACACCTCACTCATGAACCTTGGGTCTTGGTCGTGCCTCAGCATCGAGCTCGCGCCGAATCT
CCTGAAGACCTGCTCTTCGTACACTTCAGCCACATCTTGCGCCGTGGTGGAACTCATGGGTTTACACATGACGAATCCTGAGAACGCATCCTGAAAAAGC
AGCAGGAACATGTTCCCACGGTCCGACTTAGGCAAGTGTGTCGCGAAATCCATAGACACAACTTCAAAAGGGCGCCTCGGTTCGATGTTCCCAGGGGAAG
GCCCTGGATTCTGGGGGCGCCCCTTGCCGCTGGCGCAATCAACACACTCTTTGACGAAAACTTCCACATCAGCGTACATGCCGTGCCAGTAGAACTCAGA
GCGCAGCTTCTCGTACGTCCTCGTGATCCCCTGGTGCCCACCCTGAAAATCTTCGTGAGCGTAATGCAGGATATCGGGTCGCAGAGCTTTCGGCACCACG
AGTCTGAGTTCGTCAACCATATCTCGGGGTCGATCTCTGGTAGACCGACTCAAGCGGTACAGGACTCTGGAATCCAACACGAAATCATCAGCGACCTTCG
CGAGTTTCCTGGCTTGAGCGTGCGACAGCTTCGTCGCGTCTCCTTTCAGGAAATCCTTGAGTTGCAGCAGGTGATCATCTTTGTCCTGGTGCACCTTGAT
GCGTCGCCAGCGTTCCGCCTGGTACTCCAGAGGTCCCATGGGTTCGCTTTGGGCTTCGATCTCCTGAGTTCGCGCCCGAGTCATTACTGCAAACACTTTG
GCCGCCACAGGCAACGGAGCGCACTCAGGTCCAGGGTTACCCAGAGTTTCGACACCCTGAGAATCACTCCCCTGAATTCCAACGTTCAATAACACCTTCG
GTCTTACCAACTTCTCGTGAATCTTGGACACCAACTGCAGATGTGTTCGTTCGTCAGCATCCTCCACCTTCCAGGATACACCAAGCGCGAGGGTCTTAGA
CGTCAGGTAGTCTGCGGCCTGGTTAAACTCTCGCTTGACATGCACCAGCCGCACAGACTTGAACTTCGTCTTCAGCACTCCATACTCGGCCAGCTTCCTC
TGGAGATTTGGCTGATTGCAGTTGATGAGACCCTGGGCTTGCTGGATGGCAATCCTGGAGTCCCCAACTACAACGATGTCATGAATTCCACGCTCAATCG
CCAGAGTGAGGCCCTTCAGAAGTCCATGATACTCAGCGTCGTTCACAGTCACGTCCTCCAGGGTGAATCCCTGGGCATCCAGGATTTCCCACCCGAGGAC
ATGCCATAGGATGCAGTCGCAGCTCCCTTGTCGCGTGGAAGTCTTAGCGGCGCCATCGAAACTCAGAATACACCCCTCCTAGTCCGCTTCCAGCATTTCC
ATACTGATAGGCACTGGAGGTTTAACGCGCCCCTTAGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTGGGGGTAATACCCGCACCCAGAA
TTGCAGCCAAGCCGTCTTCATCCCGTTGAACTCTGCGTATCTCCAGGTTCCAGTGGGACAACTTCAGACCCCACTTCACCGTTCGACCGTCTGCCGACTG
TGAGGTCAGCAGCCACTTCAACACAGAATATCGCGTGTAGACGACGATCTTAGGGCTGCCTTCAACCAAAGTGCGAAACACCTCCAGGACTCTCAGGATA
GCAATCACCTCCTTTTCCGCAATGTGATACCGCAGCTCAGCGTCATTCAGGACGCGACCTGCGAATCGAACCGGGTGCACAATCCTGTCGTACTCCTGAC
CCAACACAGCGGATGCTGCCCACGGGTTCGCGTGGGGAATAATCACGAAGGGCCTTGAACGATCAGGATGTCTGAGTAACGGAGTCGAAACAATCTTGTG
CTTCAGGATTTCAAAGGCTTCCTGGGCTCTCGACAGGTCTCTCCTGGATTTCACTTGTTCCTCAGTCAGCTCGTACAGGACGGCCGCGATCACGGGTAGA
TCTTCAATGACCTTGTTGTAGTAATTCAGACTCCCCATGAAACTCTGGAAGCCTTTCAGTGTCGTCGGGAACGGCAAGTCTTGGACCCCCTTCGCGATTT
CAGGGGTCGCTCGGATGCCCTCAGCACTAATCTCGTGAGAGAGGTACGGAATGGACAACTTCCCGAATTCGCTCTTGGGAAGACTCACAGAGATAATCCA
GTAACGTAGTCGGAAGAGCAGCGCGTTCAGATCCTGGCACAGCAGCTCCCATGTAGGCGCACCGTGGGCGATGTCGTCGATATACGAGCTTCGACCCAGG
ACAGGGCCCATCTGAGAGGGAGCCAGGATGTTACGCTGAAAAACAGTCATCTCATCCGTCAACACTGAAAGTCGCGGTGCATTCTCACCTGAAACTCTGG
GTTCCCCAGAGTTCAACCCCAAAAAGTCCAAGACATCTTGGTCGACCTCAGCTTCTTCCTCAGAGGAAAGCCGCAGAAATCCCCACAGACAGTTATTGAG
AACTGCCTGGTAGATCAGCGGCGCGTTCTTGAGGTCAAACGGCATCCTGACCCACTGGTAGTGCCCATAGGGACAGACGAACGCAGAGATCAACTTGGCT
CTCTCGGTCATCTTGATAGCCCAGAAACCACTCGCCATGTCCAAGCTCATAAACCACATCGCCGACTCAAAGCCAATCAAAAGATCATCAATAAACGGCA
GCGGATAGTGTGAGAGCTTGATGAAGCCATTCACCACGCGATAGTCGATACACATCCGGATGTCGACCCCATTCTTCTTGAGGACGATCACGATTGGAGA
TGCCCAGGGGGACGAAGAAGTCTCGATCA