Description :
From Genome Similarity Track
Location :
Scaffold_46:222979- 232064
Transcript NameFunction/comments
Hyaar_Emoy2806131Monovalent Cation:Proton Antiporter-1 (CPA1) Family
Hyaar_Emoy2806132PREDICTED: E3 ubiquitin-protein ligase UBR3-like
Hyaar_Emoy2806133PREDICTED: E3 ubiquitin-protein ligase UBR1

Sequence
9085 bases(100 bases per row)
GGAAATGTGATTCCGATCCTCACTTCACGGCCACAATTCCACGATGCCATGAGTGACGATATGGAGGACTCTGAGGTGGCTACATCCACGCATCGCACTG
TTGATCGACCTCTGGGCGATTCGCTGACCGGTGCGTTCTTCCGCAACTGGCAGGCATTCGATGCTTCATACATGCAGCCGGTGTTTGGAGGATCATTGCA
GCGACCCACTGCAGCAACAGCTGATGTCGATTTGGTCAATATGGGCCTGGACAAGGTACCGGTAGCGAGTGCCGTGTAAATAAATTGTAAGTCTAAGATC
CGTCAAGTGTAGCCATTTTTCTCAAAGTGAATAGACCCAACTGTATCATGTTTCAGGGTACTGCCGTGCGGATGCAATTGGAAAGCTATGACGCCGCCGG
CGAACGGCGAGAGCGTCAACGCAGCCGCTTCTGCAGCAACGCAAACAGCACTTAGCATCGAAGAAGCTACACGAGCTTCTTTACAGTCGAACGAAGGTAT
GAAGGTGTCTGCTACCACTGGAATCGCTGCTGCTGCTGCGAGCGGCAACGAGGAAGAAGACAAAATGGTCGAAGCACTGGAGAATTTGATTCTGGAAGCT
TACAACAAGATGCAGATCGACGGAGAGTGCATCTTTTTGCCAGAAGAAGTTGCAGAGAAGCTACACCAAGCTGCCGAGCAGGTTTTGTGACGTGTTGGTG
ACGGTGTTTTGGATGCAGTGGCTTGACTTCGTGGTTTTGTGTGACGTTAGGTGCGCATGCCAAACGACGGCGGGAAGCAGGAGATGGAGGAAAGTGCAAG
TGATGGAAAAGATAGCGACAGTGTTGATGTCTCTGCAAGTACGGATGAAGTGGAGGATGCAGTGGTAACTCTGCTGCAACAATCGTCGGACAGACTCGAA
CCTGAGCACGAAAAGGAGCAAGAACAGGACAAGAAACAGGTGGAGGCGATCGAGACAACTACTGGGGAGAAGAAGCTCGTGCAAGAGGGAATGAGGATAC
ACAGGATACAAGTGCTGCAGGCTGAGGTGATTGAGCTGTGCGAAGAAGAGCATGAGCAGCAGATTTCTCGAGCGCCCTCGACAGAGAATGTTCTTACGGA
TCTGACGACTATAGCTGATGCAGATGAGGTTGTTTCGAGCGATCCACTCTCACCGTCATCGCCGCTGTACTCGCAGTCGCGTAGTGGGGTGGATATACCG
AACTCGAGGGTGTACACAAAAGCTCAAAGACCCGGCCACTTCCCTCCCCCGCCCCTCATATCATTGAGTTCTACTCCAAGCAGTCTTGCTGCGAGCTCAG
GTCACAGCGGAAGGACTACATCATCAAGACCAACCGATCAGCCTAGTGGTGGCAAACGAAAAGGTAAGGGGATTACTTACGAATCACGAAGAGAGGCTGC
ACAAAAGCTTAAGGAAGACAAAAAGAAGCGCGAGCTGCTCGTTCGCGAGGCTGCACGGAAACAGCGTGAAGTTGCAAAGCGGCAGCTCGAGGAGTTGCAG
CAGCAAAAGATGGAAGAGAAACGTGAGCGTGCACGACATATTCGAGAAGAGAGGCTGCATCGTCGAGCCGGGAAATCGACAGGTGCTAAAGGGACAAAGG
GGTCGGGATAGTCGAAAGTGTGTCGCACGGGTGACGTCCTTGTGAATGCTACTTGTTAGAGGCGTCCATGTAATTAATGCTATTTTATTTCTGCCGACTG
TTTGTGCATTGATTTTCATACCTTTCACTCCGCGATCGGTCCAGCATTCTGGTTACTCTCTTAAGCACTGGATTCATACCGTTTAACGAGGACCTCAGCT
TGACATTTTTCTAAGTCTGCTCTTATCAGATCAGACAGTGTCCCTGAATGTCACGTCTGTACGTAAATGCAGTTATTCAGGATTATTGCACGAATACAGT
CTCCAAATAAGAAAGCTGTTGCGATAACGCACCTTATACACCCGACGTCAACGACCGAAAACGCTATCGTGTCAGCTTCTGCGTTGCAGTATATTCTATG
GACCTCATTGGTCGAAATACGCTAACCCGACATCAAAACCACATCTTCGAAAAAAAGACCTTCATTCATCAAATAAACTCAATGGTAGCAATCCGAGGCA
AGAAGACCGCAGCGACGGCGAAGCGGAAGGCACTAGCGGCCAAGGTCAAGGCTTCTGCTGCCAAAGACACCGACAACAGATGTGTCACGCGTCCTGCGTC
CCAGCAGACGTTCACGCGGCACCGCGAGGAAGAGTTTCTGGCGCTCGTGCGCTTCGCTTTACAGAGCAACTTGGCACTGACTGGCAGCGCGGGAAAGTCG
GTCTCTACTACGTGCACCACGCTGCTGACGTCGCTGTGTGCTAGTGTGAAAGATAAGGCGCTGCCTCCCACGCAGATCCTATCGAAGCTGCCGCGGAATG
AGCGCAAGCGCGTGTGTGGCGCCATCTTCTCGGCCGACGAGATCTCGTACAGCTGTCGCAATTGCCAGTTGGACGCCACGTGCGTCATGTGCAAGGACTG
TTTCGTCCACAGCGACCACGTGGGACACGACGTGTACTTCCAGCGGACCACGGCTGGCAGCTCCTGTGACTGTGGCGATGTCCACGTACGTTTGGATCGC
GGATTGGCTAAAAAATGTTTTTTTAGTAGTATTGATATTAATTGACTTTTTATCTTTTTTGTGAATGTTATTTTTCTACAATTTATGCTGGTGATAGGCG
TGGAAGAAAAGCGGCTTTTGCTCGAGACATAAAGGAGTCAAGTCGTCGAACGCCGGAGTGCAAAAGCATAAGCTACCGAAACCCATTTGCTCAGCGGCAA
CTGTCGTGATTGGTGCAGTTGTGGAGCATATTTTTCAGGTGTTGCTGGGAACGGAGTATGGTTTCGAGCTTGCAGAAGCGTTGGAGCTGTTTACGAGAGA
CATTCCGCCAAATTTGTTACCAATTCAAAGTGATATGGATGGACCAGATGCTGCCGGAAGTAAAGCGAGCGCTGCATTCAGTAGAAATCGATCAACAGTG
GCGTCAACGCGATCGATGCGATTATCGGCGCAATATACGGCTGAACCTGGATCGAGAACTGTCGGACCTGGTGGCAGGCTAGAGGCACAAGCAAACGAAG
TGAAGCACGGGGCGATTAGCTCAAGCGATGAAGTGCTTTTTGGCATTCGTCTTCACAATGACGATATTCACTCGCTGAATGAAGTGATAAATCATCTGTA
CGCGGAATTGGGTCTGTCCAAATCCCAGGCGCGCAGTGTTGTAAGTCAAGTAGACGATCAGGGCGATGCAACGGTTTCAACGAAATCGCTGCTATTATGC
CCGGGAGTTGTTGGAAATCTAGTGCGTCGCTCACTGAACGTCTCTGTCGCACCTACTTGGTGGGAAAAGCAGATGGAAGGATTGCCCGCTCTTTTGGGGT
GGCTGCACTATATTAGCACAACGTCAGATGGGCTGAGCGAGATTGTGTCGGAAGCACTTCAAAACCACCGAAGTCCCGTTCTCCGAGGATTTATGCCCGC
ATCGAGCACTTTGCCCAAGAAAACGACGGTTCAGGAGTTTGTAAGGGAGCGCCGCATCCGCCTTCACGATCACGCTTTGGATGTTCTTGTTGGCCTCGTT
GCTGGAGGTAAGGATGTTTACACGTGGGCTTGCGAGCAAGAAGCAGCACAGCGTCAGCGCTTTGATTTTCGTGCGGAAGGCGGCACAGCTTCTGTGGCAT
CTACGGGTTTGCTCGCTGGAGGGAAACATGTTAGCTGTAGAAACATGTTTCTTGAGGAGTTTGTCAAGGCTGTGTCACTGAGTCCGTCGTACCGCAACCA
CGATCGTGTCCGGCAAAGCTTTGATGTAGTCGTGGCAACATATTTCGCATCGGATCAAATGAGTGATGCTGGCACTGCTACATCAGCTCTAGCGCTACTC
ATGCGGTACGATTGTACGTTGCGAAGGAACGCTGTAGAGCGGTTGCACGCATTGTTACGTGAGCACCTGGTTGACATTCAATTTCGGGCTAGCATGCTAG
AAGCATATTTGCAATCGTACGCCTCAATGACCCGTATGTTCCTCCGTGGCCTGGACAATTCGAATGAGTCTATTTTCGATTTTGCCGAGCAGTTCTTGAC
TGTACCGCATCTGGTACAAAAGTACACAGCACACTCCAGAAAACTGGAGCTGGTTCGGGAATTACTTTGTGCTTTAAACACAGTACTTAAGTCTGCTGTC
GACGACAAGAAAGGGAGCGTGAACGCTGACCACCCTGCCCTTAGCAGTCAGAAATATAAGGTAAGTGTTGTTTGGGTGATGACAGAGCCATCGAAAACTC
ACTTTTTCCGATGGTATAGCACTGTGTCGAGAACATGGAATGCGTATTCAGTATCGGTGCCCTCTCGAGCGATCTCGTGTGTAGCGCGGAAAATTTGAAA
ATTTGGCTTTCTTGTCTGAGCATTCTTCAGGTACGAGACCGAATCGTTACTGGTGAGCGTATTGTATCACTAATAACGTTTGATAATTTTGCTTGTAAAT
AAGGGTGGCGATCCTCAAGTACGTCGGGGCTTTCACCAAAATCATGTGGAATACGAATTAGACAGCTGGTTGTCAATGTTTAATCTTGGTATTCGCATTC
ACTCGATTTTTGCGATCGCCTGGAACGGTTTTCACCCAGTCGAGTTTGTAACGCCTAAAGTGGATGTAGCTGCAATAGTCCGCCCTATAATTGAAGCCAC
CATTTTGTCGTCTACCCGCGCCAATGAACGAGCGGCGAAGAAGACGTTGGTTTCAGTGACAAGACTAGTGTGTGGGGACAAAGGGGTTGCTGGGAATCAA
GAAGAAGATCGTATCATGACGTACGACTTTAACGTAGCATCCCAGCCAACCTCGCTCCACATACCTTTACACCGTTTCCTGACAGCTGCTGTGCGGCATG
TCTGCATTAGTCCAACAGGTTTAGGAGATTCCATTCCTTCAGACGGGATTTTGAGAATTTTTGGGTTTGATGAACTGCCGGTTGACATGCAATGGGAGCT
CGTGGAGATGCCACTTCGATGTTTGGTGATGGCATCTCAAATCCACTCCAATCTCTGGCGTCGAAATGGAGATGAAAATATGCTGGCACAGCTGTACAAC
TATTCAGCTCTACCTTATTGCATCCACTACCGTGACGCCGACACACTAATGCTGCAGCTCGGTGTGCTCATGACTGGCGCTGATGCCCTTTTGGCACGAA
TGATAGATCGATTTCAACTTGGCAGTTATTTCACACTGCCTCGTAAAACTTCGTTAACAAAATCCGATCAAGATAGCTCGACAGGATCTGACGGTTTAGT
GAAGCAGCTTGGGTTTGCGGAAGTAGAACAGGGAATAGATAAACAACAAAGCCTGCAGATGCTTGAGGAGTTTCTGCGTCTCGTGATCACACTTGGCACG
AGTCTTCCGAGCACGACTGGTTCAACGTACGATAACGAGTATTTGGCGGAAGAGATGCTGCAGCAGTTGTGTGCAAAGTCACTACCATTTAGTAAGCTCT
CTGATCTGGCTGTCCTGCCATCAGGCCAGGATGATATCCCGACAGCGCGGCTGGAAGGGATCCTCGCGACTGTGTCTGATTTCGTGCCATCATCTGGGCT
TGAGCCGGGTCGTTACCAATTGAAAGAAGGTATGCTAGAGGGCTACAACCCGTACTTTCTTCACTTGAACCGTGAAGCGCACGAGCTAGCTCGGGATCGT
TGGACGACCTACCGCAATACGTGCCGTCTGAAGTTGAACCAAGCTACCTCCGATAGCCCCCCGAAGGAGCCATTGAAGGCAGTGAAACCTCCGGTTGATT
TCTTACGCCCAGTCCAAGCAATCCTGACATGCGAGAGTACTGTGGCGATTACCCATGTTATTCTTTGGAAGGTGCTGTCCTCGGGTCATTCTGAGTCAGC
GTCGGCAGGTTCGGAGAAAAGTGTCTCCGACGCTATCGTTTCGACTTGTTTGCACTTGCTGGTCCACGGTGTCCACACGGCGTCATTTGGCTCTGATCAT
CGCTTCTGGACTCGACTAAGCACGGCAAATGCTGCTACCTCTGGGTTGTCACTTCTAAACCTTTTGAGCCAAGTACTCGAGCGGGCGTCAATTTTACTTG
ATAGCGAACAGATTGGTACGGTCGAGTGGCTTATTTGGAAAATTTCTGCTGAATCATCTGTTTGTCGAGAAACATTTGAGCAGTTTGCTCGTGATCCAGG
GGAAACACTAAAGAAGACGAATGTGTCGCTGTTGTTATCGAGTGGTTCCGTACAAGGTGGCCCTTCCCAGCCGATGACCCTAGAACAACGAAAAATAGAG
GCAAGGAGAAGAGCAATGGCTGCAATGGCAAAGCGTCAAGCCGATTTCCAAGCGATGGTGGACATCTCGGATAAAAAAGGGCAAGTGAAAATGGATGCGT
TGGCGGAAGACAAGTCAATTTATGAGACCCGTTCGTCTTTGGGTAAGCGTAAGGCTTCGGCTTCTGACCAAATGGAGGAAGTTACGTCAACGGACCGAAA
ACTAAATAATGAGCGAAGCTGCAGCTGTATTCTTTGCCATGACACCTCGAACCAAGGCCAGATGGGAATCGCAGCCTACGTTCATCAGTCCACCGTCTTA
GCTCCTGGGTTTAGACCAGAGCCAAGCGAAGCGCTCGGCTTAGAGGGCAGGAAGACGCGTATCCGTGTGAAAAGTATAGTCGAGAAGATGGGGCTGTGTT
CAGATGGCGGCTCGGCCTCATCTGATATTGCGAATTTGTCGCCGACCCTGCGTGCTTTTGCAAGCACTTTTCCTGAATGGTACATGGACAGCATGTTGGA
TGATGACCTTACTCGCGATAACACGGCAAATAATAGTCCTCGAGCGCCAACGACTCGCCGCCAGCGCAACGATCGCATCCGCTTCGGTAACGGAAACATT
CCGATACTCGGAGGTGAGCTCCTAGAGACGGAAGAAGATTTCGGAGTTCTTGAAAGCGCTTTGGATCTTCGTGAGGACCAACGACTTTTCCCAGTGGATG
GGCGCGGCATTGTGGGTTTGGATCGTCGTGGCGATGTGATTGAATCACGTGGATTGAGAGATCATAACGCAGCTCGCGGTGGCAATACTCGTGACCAAGG
TGGGGATGACAACGAAGAAGTAAGTCTTCCCCGATTTCGCCCAGAACAAATACCACCCGGATTCGGTCAGCCTCACCAAAGTGCCAAACTGTATGTCACC
CCATGTGGATTACACATCCGTACATGCCAGCACGCGGTGCACATCCAATGCCTTGAACGCTACATCACTTCATTGCATGACAAAGCCATGCGCGGTGAAG
AATTTGACGGCGTTCAAGCAATCGACCCGGATTCAGCAATGACGCAGTTTTTGTGTCCTTTGTGCAAAACGTTGAGTAATTTCTTAATCCCCGCATCGGC
TCCTCATCTTTCCATCGAAAACGGGGATATTTGTGAGTATAAAAGTGCAATAGGTGCGCCGACACGCGATGAAGAAGGGAAACTTGCTTCTTGGGACGGT
ATAGTGGCGGAACAATTATTAATGCCTGGATGGTACCGCTCAGTGCTCGGGCGCGACGGTAAATTCGAAGATAGGGACAACGATACTGAACACGACTCAT
GGCGGGATTATTACGAGGAAACGCTGTGGGAACCTCATGGCAGTTTGGAAAAGGGCGCACCTTTCCTGTGGTCTGCGTGTGCGTTCACCCTGGCCTCGTT
TTTAATTGTTGCAGAAGACGAGTGTCGTGCAGACCCCAGCTGCAATTCAACGTTCGATCCACTTACAGACCGATGTCCCCCATCGATGGAAAAAGAGTTT
GAGTCGCTGATAGCAGTCACGAAGTTTTGCAGATGGACGTTCTCGCTTTTGGAGCATAGTGCTGACGCGAAGGTGATTTGGGAAACCGCTAAACGTTGCT
GCCCAATCAATACCGAGACAAACCGCGAGTACCGCAAGTATACGAAGGTAGGAATTCTGCTGACTTCTGGCGAGGATAGGTGCCGAGTGCGTCGTCTGAT
AAATAATGTCTGTAATGACCAGGTCCTTGGTTCGATCGATGCTTGTCTACGCGGAACTATTCTGGGTCTGCTAGTAGCGGACACTTTCACAGTACGTCAC
GAGATCTGTAAAGGTATCTATGGTCAACGCTAACGGAGTATGTGTTGCAGGCTTTCGTGGTGGCCAGCGTGATCGCAGATGGACTTGAGACTATTTGGCG
GTCTATTCCAGTATTTAGCGCTGCTGATTTGTTACAGCGTCTGCATACCGAATTTTTTCAGCCTGGCAAGCTTGAGGGAGTATCGCTGTTTGAAGACAAA
TCGTCTGCCGACGCAACTACCGAGGCAGAGCACATGGTAGCCACAGCTACGGCAGCGACTAGCGACTCTGCCTTGGCTCCGCGTCGCACTCGAAGTGGCC
GTGCTATCGGCTGTGCCGCGAGTACTAGACCTACTGAGGCTCCCACGAGGTCCGCAAAAGAGTTGATGCGAGTGCTGGAAGCTTTGGGCGAGGGGGGCTC
TGAGACATATGCTGTGCTGCAGCTTTTGCAACGAATGACAAAGGTGTATTCTGCCGAGCAGCTAAAGCCATTCACGACCGCGGGCAATGTAATCGTCCGA
CTGAAGCACATTGTAGACGCAAACAATGCTTTCGTGCGCCGCATGAAGTTATTCTGGCGCTGTCTGGCGAATGAAGGTACCAGTGCACCCACAAGTACTA
GGACGATGCAGATCCCAACATTGATCGACGTCGCTCGTAGCTCAGATGCTACATTTGACCAAATTTGGCGATGGTGCATGGACCGTATGCTCAGCAAGGC
CTACTTGGGAGCTTCAAAGGCCGGCGACAAGTGCGAACACACTGAAGGCTGCAGCGAGGCCTATGTTGCTAGCATGTTCATCCTTCGTGACATACCTACG
CGACCACGATTAATCGAGTTACCTATCCAATTCGACGAGCTTTACAGTGAGATGGCAGGCCGCAAATGCACGCGATGTGAAAAAGCGCCTTGCGATCCGG
GTCTGTGCTTAATATGTGGCGAGTACCTGTGCTGTGGAGATTCGTGCTGCACCCGTACCTTCATGCCACATGGACCACCGGTTGG