Description :
From Genome Similarity Track
Location :
Scaffold_1037:2229- 4429
Transcript NameFunction/comments
Pytve_DAOMBR484snap-pve_contig_1037-abinit-gene-0.9Myosin

Sequence
2200 bases(100 bases per row)
TCCTTGTGCAGACGCTCAAACACGCTGAAGCGGTGAGACACGAGCCACGCGGTCGACTCCTGCGCGTCCTGCGGCTGCCACGTGCAGCGCAGCACGTACA
CAGTGTACTCGGCGTAGTTGTCGTCCTGCAGGACCTGCGTGCGGTGCATCTGGCAACCGAACACGCCGTCGTGGATCATCACGCGTCCACCCTCGGACGA
GAACGAACCGAGCGGCGCCGTCAGCGTCGAGTAGCTGCCCTGAGCACGCGAGAACCCGCGCGGACGAGCGCCATAGTAGTCGCCAGCGCCGTACATGTCG
CCGCCAGCAGCAGAGTCGTCGCTCGTCGTCAGCAGCGAACCACACTCCTCGCAGTGGTTGCCGTTCGCAGTGTTGTTGGTGGCACCGCAAGCCGGGCAAC
GGATCTGAATGCCGTACACACCGGTCGAGTACAGACGGTTCAGCGACTCCTCCTGCTCCGCAGTCAGCACGGCGCCAGCTCCCGGCTCCTCCGACGGCTT
CTCCAGCAAGAACGGCACAAGCTCGTCGTACTCGCTCTGAAGGATCGCGCCACTCAGCAGCAGGTCGTTCAGCTGCTCCAGCTGCTCGCGGTTCTCCTGC
GAAATGTCGTCCGGGATCTCCACGACGTGCACCTGGCCGGCAGCCGTCTGGACAGCGTTGACCTGAGCCAGACCGCCCAGCAAACTCGCGCTGACGCTGG
CAGCGTGAAGAAGAGCCTCCTCCTTGCGCTTCTCAGCCTCGGCACGCTCACGCGTCATGCGCTCCTCGAGCTCGCGCGCTTCAGCAATCGCACGCAGCTC
AGCCTGGCGCTCGTGTTCAACCGCGGCAGTTGCCTCGGCAGCAGCGGCCTCGGCCTCAGCGACGGCACGGGCGGCTTCCTCCGCCAGCTTGATAGCCTCT
TCCTCGGCACGACGCGCCTCCTCCTCCATTTGACGGCGGTCCTCCTCGGCCGCTGCACGCGCGATGCTCTCGCGACGGGCCATTTCGGCCGCCAAACGCG
CTTGCTCCTCCTTGCGTCGCGCCTCCTCGGCCTGGCGACGAGCTTCTTCAGCACGCGCGGCGGCAATCGCGATCATCTCCTGCTTCTTCGACTTGAACAG
TCGGCGAGCAGTCATGCCGCGGAACAGAGCCTGGACAACAATCGCAGCAGTCCGCTGCTTCTTGAAGTCGCGGCGGACCGACCAAGCGCGCCACCACTGC
TGGATACGGACAACAGCGTCGCGGCGGAACTGGATACGGAGCAGACTCTTCTTGAACGCGTTCTGCGCCATCACCTTGGCGAGACCCACGCGCCAGCGGC
GACGAGCCAGCCACAGCTTCATGCGGCCCACGATGCGCGGACCATCAACCGCCCAGTTGATCTTCAGAATCGAGTCCAAGAGCGCGATCTTGCCAGCCTT
GAAGAACAGCTTCGTGATACCGAGCTTGAACGCGTCCATCGGCACCTGGAAGGCCCACAGGATGGCCGTGATCAACGTCGGGTCACTCTGGTTCGAGAAC
AGGCGCTGCGCGTCCGGCGGCATGAACTTCTTGTATGCCGTGACGAGCTCGCTGTAGCTCACACGAGTAGGCAACCCGACCTTGAGCACCTGCGCAGTCT
GCATGATACCCTGGCATCGCAGCTGGCCCACGACGTAACGAGGGTCGAACAGACCCACGCGCATCAGAGCGTTCGGCTTGATACAACGGATGAAGTTGCA
ACGCGTGGCATCCAGCGTGTCAACCAGATCCTGCATCTGCTTCGAGAACTTGGCAGCCACACTCTTCATAATCTTCTTCTTGCCGGGACGCACCACGGCT
TCGCTCTCGTCCTTGAACAAGGCGACAGTCAGGTGGTTGGTCGAACCCAGGAACAGGTTCGTCATGTCCGGCGGGATGGTGTCGTTGTTCTTGTCAATGA
ACGCGCCAATCGAGTACGACACCGATCCAGCGAAGTGCCGCACAATGAACATGTGCTGCATGTCCTTCGGGTGAGGACGCGGGAAGTACGCGTTCTTGGC
GTGCTTACGATGCAGCGTCGCCAAGAACTTGTCGTCGCTTGGCTGCGGGTTCATAGCCTCCGCATCCAGCAAGCTCAAGATACCATCCGGCTTCGACGCA
ATCAGCTCGACACACTCGCGGTTGTCAGGCCACTTGATCTTGCCGACCGTGATACCCTCGCGCTTGTACAGCTCCATCTCGGCGATGAACACCTGGTTGT