Description :
From Genome Similarity Track
Location :
Scaffold_24:222871- 224475
Transcript NameFunction/comments
Physo_133087hypothetical protein

Sequence
1604 bases(100 bases per row)
ACTGAGAAACGAAACGATATGGAGGAGGAGGAGGAGGACATATCCGAGTGGGGGGTCAAGAAGTTGGTTCTCGAGGACGTTAGAGATGTGGACGGCCTGT
TGGAGACTCTAAGCGACCCCAATGTTCGGATGGCTCGGGAGTTGGTTGAGCTGAGACTCACGTTGACCAATGACTCAATGGTTTCGCCGGAATATATCGC
TGCGCTCGAATCACAAGACGGGAAGTTCCTGCCTGTGGTCAAGCAGAAGCTCCCTACCCGCTCGAAACTCGCGATGATCAGTGTCGCTAAAAGCGACGAC
GATGCGGAAGACAAGAACAAGGCGACTCATCAGCTGGATGAAAGCATTCTGAGGTTGGTGTTTGCCTTCGCAGCAATCCCAGCGCGGCGATCTGTTCGTG
TCTCCAGAAAGGCTGGTGGTAAACATACCCAGAATGGAATCATTCATAATAACTGCCCCGAAACTGAATTCCCTGTTTGTAAGGCAAGGACTAACGTTAT
TAACTAACGTTATTACAGCACGGGGAATCCACATAGCTTGGTCCAACACCGTCGCGGAGGACAAACCAACCATCACAAGAGCTCGGAGCACCCGCGTGAG
AATGGTGGAGCTACCAGCAGCAACGCCAGTGATACAGAGGCCGAGGAAAGAGCGCCATCATTTGCGTCCAAACTCAACGTGTTCCTTGGGGCCAAGAGCG
GCGTCAACACCAAGCTCGGCGGCATATTCAAGGATCGTACCATGCACGCGGTAGGAGAACTACCCAACAGGGACTATCGGACAGGGCGATGATGACTCGC
GCGCTGGGGCAGTCGGATACGTCGATGTGCAAGATGGAGCAAGAAATCCAGCCTTTGGTGTGCAACGAGAGTGATAGCCTCGTATTGGCTCCGAATTATC
ACTGTCGATACGACTCGGCTTCAACGCAGAAACAAGCGGAAGTCGTTGTCCCAGGCTATGGACTCTCCAGCGGTAATGCTTACTCCAATACAATCCACCG
CTTTTCGAAATCGAGATCTGAAGAGACGTATCCATGAACTTCAATCAGCATTCCCTACACTTTTATCTACTTTTAGTATCTACAGGTTCGCGCACCAACG
CTGGCCGTCTTTCGAGTATAAGTTGCACAAGTTGAGGGCAACCGGAGAAGTACGCCATCGACAACACCACGAGTCTTCCAAATCCACATCAGCGCCAGCG
TCCAGCAACACTCGAAGGGGCTCTAGTCGGTTGTACATCGCCGCCATCAGCGACGCAGTCGCTCCAGAATGGGATTGAATGTCCATGCCCGCCCCGTTGT
TGACAAGAAGCTGGACAACAGCGTCGTGTCCATTCTCCGCCGCGATGAAGAGCGCTGGGGTACCATCGTCATACTGCTCATCAAGCGACGCCCCACCATT
AATCAGTACTCGCGTTGCGTCAACGTGGCCAAACTCGGCTGCAATTCGCAATGCGGTTGCTTGTTGGGGGCCTTTAGCACCGATGGAGGCCCCATGCTTC
AACAGTAAACGTATGACGTCGCTGTGACCGTGTAGCGCAGCATTCATGAGCGGAGTCCATCCAGCTTTATCCGGTCTGTTGACATCCGCCCCAGCCAGAA
GAAG