Description :
From Genome Similarity Track
Location :
Scaffold_178:22286- 23729
Sequence
1443 bases(100 bases per row)
GAATACGACTCGTTGGTCAACAACGGCACTTGGACCCTGGCGGCGCTGCCCCCTGGACGCAAGGCGTTGCCTTGCAAGTGGTTGTGGCGCAAGAAATTCG
ACGCCGTGGGCCGCTTTACCAAGTACAAGGCTCGCCTGGTGATCAAGGGATTCATGCAGCGTTACGGCCTCGACTACGAAGAAACCTTCGCGCCGGTGCT
TCGCTACAACACGCTGCACTTGGTCCTCTCTTTGGTTGCGTTTCACGGGTGGAAGATCCGGCAAATGGACGTCAAGACAGCGTTCTTGAACGGACTCATG
GACGAAGGCACCGAAATCTACATGCTGCAACCGCCCAACTTTGCAGTGCCTGGGTCCGAAAGTCTCGTGTGCAAGCTGCTCAAGGCGATTTATGGACTCA
AGCAAGCCCCAAGATGCTGGTACCTTACCCTGCACAACTTCCTCGTGGAGATCGGTTTCGAGCGTTGCGCCAAGGAAGCATGCCTATACGTCAAAAGAGT
GGGAGAATGCATAAATGCTTTTGACCGTCTACGTTGACGACATCACTATCACCGGCAACAGCAACGAAGATATCGAGAAGGCGTGCGACGACATCAAGAG
GCGCTTCGAGATGACCGACCTCGGCGAGCTCAAGTCCGTCCTTGGAATCCAAGTTGAAGTCAAGTCCAAGGTGGTGGCAATGTCCCAGCAAGGCTACATC
GACGTACTCTTGGACAAGTACAAGATGGTCGAAAGCAACCCCGTGCCTACCCCGGAAGTCGTCGGCCATGTGCTAAAGCCAAGCAAGTTGACGCCAAGTG
AAGTGAAGAAACTCGACCTCCCGTACCGCGAACTGGTCGGAAGCTTGCAGTACTTGGTCACGTGCACCCGGCCGGACATCGCCAACGCCGTGCGAAATCT
CTCGAAGTACCTGTCGTGCTTCGATGAGAGCCACTGGAAGCAAGCCAAGCGGGTGTTGCGTTACCTCAAGGGCACCAAGTCTCTTTGCCTCAAGATCGAC
TGCTCAGGGCAAGTGGGAGCGTTCCAAATTGAAGCCTTCTGCGACGCCGACTTTGCCAACAGTGAAGACAAAAGATTGATCAGCGGCTTTCTCGTCATGT
TCCTCGGCACAAGTTTGTCGGCAAGGTCGAGGAAGCAATCGATGGTCACGCTCTCGACCGCCGAGGCCGAGTACATTGCACTCTGCGACTTGGTCAAAGA
GTTGCTTTGGTACATCGAGCTGCTTGAAGAACTGGGGTTTCCCCAAGGGCCCACTGCGACAATCAAAGTGCCATCGCCATCGCGAAGAACCCCGGCCACC
TCGAGCGCACCAAGCATATCAGCACCAAGTATCACTTTGTGCGCGATCAAGTGGAGAAGGGCCGTATCCAACTTCAGTACAGCCCGACGAAATTGACGGT
GGCCGACATCCTCACCAAGGCCATTCCGCGAGAGCAATTTGAG