Description :
From Genome Similarity Track
Location :
Scaffold_11:222824- 223899
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005093Similar to Uncharacterized protein C20orf26 homolog (Mus musculus)

Sequence
1075 bases(100 bases per row)
CTCTGGCGGCGGCGGATTGAACTCGACATGGTACGTTCGCCCAGTGGCAGGATCCACGCGCCGCCCTGAGATCCGCGAAACAACTTCGGCGTCAGGAACG
TCGAGCACCAGCACGCAGTCCGGGATCACACCTCGAGTGAGCATCGCGCGTGCCTGAGTCGCTGTGCGCGGGAATCCGTCTAAGAGCCACCCGCGACGAG
CGCAATCCGACTGCTGCACACGCTCTAAGATCACATCAATGATCAGTTCATCAGGCACAAGCTCACCGGCCTCCATGTAGCTCTTGGCTTTCATGCCTAG
TGGCGCACCGGCTTGGATACTCGCGCGGAGCATGTCGCCCGTCGACAGGTGTACAACGTCAAAATGCTCCACGAGGAGCTCGCACTGTGTGCCTTTCCCT
CCCGCTGGTGGACCCGCGATGATGAGTTTTGGTGGCGCACATTTACCCTTGCGCACGAGCAATTGGAAGAGCTGCGCGTTCTTGTGCGAGCGAACGTCGT
CGCTGATTGCTTGTGCGATCACGTTCTTGTTCTGCATCCCATTCACGCGAATCACGATGGAGGTCGCCGCAAACGAGTGGACCACGGCATCGCAGTTGGC
ATGGAAGTTTACGAGACGGTTGCGAATCGTGGCCTCCGTGTCATCGGATCGCTGGATCAGCCGTGCGCGCAGCGCGGCATCGTTGGCTGGTGGCGGATTG
AACTCGAGATGGTACGTTTTGCCCGTCTCTGGGTCGATGCGCCTTCCCGAAATGCGCTTCACGACCTCTTCGTCGGGTACGTCGAGCACAATGACGGCAT
CAGGCAAGATACCATGCGCGATCATCGCTTGGGCCTGGTTCGCAGTTCGCGGGAAGCCGTCCAAGAGCCAACCGTGCGTCTGGCAGTCATCGTGCTGCAG
TCGGTCGAGGATGACATTGATAATGAGCTCGTCGGGGACAAGTTCGCCTGCTTCCATGCATCCTTTGGCAGCATTTCCTAGCGGCGAATTGACCTGGATT
GCAGCACGGAGCATATCTCCCGTAGATAAGTGCACGACGCCGAAGGCATCAACGAGCAGTTCGCATTGCGTGCCT