Description :
From Genome Similarity Track
Location :
Scaffold_388:2228- 6977
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_388-snap-gene-0.15Kinesin heavy chain
Pytve_DAOMBR484maker-pve_contig_388-snap-gene-0.16Kinesin heavy chain
Pytve_DAOMBR484maker-pve_contig_388-fgenesh-gene-0.9Conserved gene of unknown function

Sequence
4749 bases(100 bases per row)
GACGATGGGTGTGCCGACCGAGACGCGCGCGGGCGTGCGCGTGTGCGCGCGCTTCCGGCCGCAGAACAGGCTCGAGCTCAAGCAGCAGGCGGTCGAGTGC
GTGTCTGTGGACGACGACGGCGCGGCGGCCACGCTGGAGGCGGCGGTCCGCGGCGGCGAGCCGCACACGTTCACGTTCGACCGGGTGTTCGGTACGGCGT
CTACCCAGGTGCGAGTGTGATGTCTAGACGAGGGTGTTTTGCATTTTTGGCATAACAGCGGTGCTGTGTCAGGCGGAGGTGTATGAGGCGACGGCACAGC
CGCTGGTGCAGTCCGCTCTGCGCGGGTACAACTGCACGTGCTTCGTGTACGGCCAGACGGGCACGGGCAAGACGTTCTCGATGGAGGGCGTGCCGGGGGA
CGCCGAGTTCGCCGGCATCATCCCGCGCGTCATGACGGACATCTTCGCGGGCATTGAGCAGATGCAGACCGAGCTCGAATTCCTTGTGCGCGTGTCGTAC
ATTGAGATCTACCTCGAGAAGATCCGCGACCTGCTCAACCCGGCGGCGAGCAACCTGAGCGTGCGCGAGAGCCGCGACCGCGGCGTCTGGGTCGCCGGTA
CCAAGGAGGTCTGCTGCGCCACGGCGGAGGAGATGATGGCCGTCATGCGTGTCGGCGGCGCCAACCGCGTCATCTCGTCCACGCGCATGAACAGCGACTC
GAGCCGCAGCCACTCGGTCTTTATCATCACGATCGAGCAGCGGAACGAGGCGACGGGGTCCACCAAGAGCGGCAAGCTCTTCCTTGTTGATCTCGCGGGT
TCCGAGAAGGTCGGCAAGACGCAGGCTAAAGGACAGACGCTCAAGGAGGCGCAGCACATCAACAAGTCGCTCTCTGCACTCGGCAGCGTCATGAACGCGC
TCACGAGCGGTCAGGCGAACACACACGTGCCATACCGCGACTCGAAGCTGACGCGGCTGCTGCAGGACTCGTTGGGCGGCAACTCGGAGACGACGCTGTT
GGTGTGTGCGAGTTCCAGCAGCTACAATGCTGAGGAGACGTTGTCTACGCTGCGCTTCGGCGCTCGCGCCAAGCACATCAAGAACAAACCGACGGTCAAC
GAAGAGCGCACCGTCGCGGAGTTCAAGGTGCTCGTGGCCGAGAAGGACAAGCGGATCGCGACGTTGGAAGCCCAACTCCGCGATATTAGCGGAAGCGGCG
AGCCTGCACCGGCGGAAGGTGATGGTGCGCGGGTACAAGAACTATTGGCCAAGATTGAGCAGCTGGAAGACGAACAATCGTCCAAGGCGACGGAGGTGAC
GAGTCTCGAGGAGAGATTATCGGAGCTGGAGGAGACAAACAAGGTGCTGCATCAGAAAGAGGTGGAGCTGACTGCCATCACGAGCCGGAACGAAGACGTG
GCGAAGAAGCTTGCGTTTGTGGAGAACGAACTGAGTGCCAAGACGCAGGAGTGCGAGGAGCTGAGCCAGCTGATTGAGCAGCGCAAGGCGAAACAAGCAG
GCTCGACTGGTGCTCCGTCAGAGCAATCTTCGCTCGGAGCAGATGGCAGTGAAGCGAGCTCTGAAGCCCTGCCAGTAGACCGTACTCGAGGCGACAGCTC
CGATTCGTTTGAGAACGAGCTGCTCCGCCGACAAGTGCAAGCCAAATCGCACGAGGTGGATCTCTGCATGACGCGCATCAAGGAGCTGTCGGAGGAGCTG
GTGAATTGCCGCAACTTCTACGATCAGGAGATCGACTTGCTCCAGGAGAAGCTGCATGAGTATGACGCGTATATCCAAGGGTTCATGGAAACCTCGGACA
AGGAAGTCAAGTCGCCTCAACTCGACTCGCTGCTGACCAATGCCAAGATGCTGAAGTCAGTTCGTGGCGGTGGCGGCAACGCCATTGCTAGTCCCAGTGC
TGGGTCGTCTGCAGCGCCTCCATCCTCACAGCGTCCGCGCATTCTTACGTCGACAACGTCTGCGGACGGCTGGAACTTGGATGAAGAGGTGTTTCCAGTG
GCGCCAATCGATATGGAGTCGGAGGTTGTGAAGCGATTGATCGCCAGCATGCCGGAGAAGGGTCGCGAAAAGCTCTCGAAGTGGCTCGTGTTTGTGCTCG
AAGGTCGCGATATCCGCTCCAACTTCCACCCCGAGATCTCGATCGAAGGCGTGAACGAAGAGCTCAACCGCGACATGCGGCGCTTGATTGTCCCGCTTCT
CAAGAATCGCCACGACCTCGACGTGCTACCTTACGTGCGCACGCGATACGTTCGCGTCTCGGACCTGAAGATCACGCTTGTCCCGAAGAACAAGGACACT
GTGCACGTGGAAGCCACGCCGACTTACGACGTGGATGACAAGCACGAGGGGAAGACTGAAGCTACGGTCCCGAACCCTGACAAGATGTGGGCGGAAGGCC
ATCTCTTTTATGGTCCAAAGACCGACGCGTCCAGTGCTTCGGTGCTTCACGGCGCTCGCGCGCTGATCCCTGGCAAGGACCGATTCGCGTCGGAGCCTGT
CGACCTCAGCGCGTCTGTGTCCGAGTCCAAAGCCGTGCTGGATGTGGCTCCGAGCAGTTCAGGGTCGAGCACTAGCAACCAAGACAGTTCGTCTGGGCCG
GCATCGGGATCTGCGGCAGCTGGTGGAGTGTTTGGTCGTCTCCGGTCTAAGACGGGTGTTGGCGCCATGTTCGGCGATGTCAAGAACCTGATCGCAGGCC
GCTACTACAAGAACTTTGTGCACGAAGACACGCTGTGCGATGGGTGTGGCATGAGTCCGATCGTCGGCGGCAAGTGGAAGTGCAACACGTGCGAGAACTT
TGAGCTGTGCGACACGTGTTACAGCGCAGGGTTGCACGGGTTCGAAGTGAGCAACGAGATGTGCCGTCGCATTGAGCAGATGGCCGTCCAGAGGCATCGG
TCGCTCGGCGAGTACCCAGAGCTGTTTGAGCTCTTCCGCCGCCACATTTGCAACGACGACGTCGTGCAGTTCCGCCGCATCGTCGAGTGGCTCACTGACA
TTGTCGCGGGAACCCACTCGACTCACATCAATCACAAGATGATCGTCAAGAGCGGGTTGCATCCGGAGATCCGAGCGCGATTGGTGGCGCAGCTCGGTGC
GTTGGCCAGCGTTCGAACGGACATTGAGCTAAAGACCGAGTGGGTTGTGGAGAAATCGCTCGAAGAAGAAGAGGCTGAGGAAGCCAGTGACAGCGATGGC
AGTGCGAGCTCCAACCAGAACGCCAGCCAGGAGAACAGTCAGGACACCAAGTCGCCTATGATCGAGGTGACGACTCCGCCGCCGTCGGTCGTGGATGGCG
AAGTTCCATCAGCTTCGCCACCACCTTCAGCATCTGCTCCGACTGATGTGCGGCTTGAGACGCTGCGCATGTACATTGCCGAGATCAAGACGACGAGAAC
CGATTCGTCACCGGCGGTGCCCTTCTCGGACTTGCTGCATCCGTCGCGCCAGCATTCTGGCACGGCGACAAGCGCTCGGTCGTCGTCGACGTCCTCGATC
GCCTCGGCCAGCGCAAACGGTGTCAATGGAGCAGCAAAGCCCTCGTCCACTGATGAGCCAGCAACGTCGACATCTCCTGCCGATCAGGCGGTGGACGCCG
ACGGCGAGCCCGTTTACAACCGGAAGCGCGTCAAGTCGGTCACGCACTTACATTTCTGAAGTTGGCGAGAGGTACGGAGGAGCTGCAGAGATGCGTGCCG
GTGTCGGATACCCGCAGTTGACAATGCGAGAAGGGGGAGGCTCATCCCATGTGACGTAGGTGCGGGGCGGCCAAGAGACAGGAAGGAGAGCGAGGTCGTC
AATGATGGATATAGTATGAGTGCAAGCGTGATTTGGTATCTTCGTTGTCTCCGTGCCCATGTGTCGTTGCGTGTGCGTGTTGAAAGAGGCGGCAGGCGTT
CGCGTCGGCGTGCGTCGAGCCCGCTCACCGCCGCGATTGGTTGCGGCTCGCGGCATTCGCTGTGACGTGGCAACGACGCCGCGTCGACGGCGCATAGCCA
CGCGAGGCCACTGCGCAGCCATGTTGCGCATCTCGGGTCGCACTGCACTGGCAGCTGAATCCACTGGCCGCGACATGCGTCCGCATCAGGTTGTTCGCCT
GGACATCAGGTCCACCGCAAGGTTCGACCCTCCCCATTGCCCAGTGCTATCCGATGCTGCCTACCTACATGAATGGATAAAGGTTCTCTCTCTCGGTTCA
ACCGTATTGGCAAAGCACTAGTGTATAGATTACGAGGAGCGGAGCAGCTAGTTTCTCACGCTGAGGCCGCCAGCCTCCTTTGAAACGCATTAAGGGTGGG
GGGGACGGAGCACGCAGATGGAGCAAAGCACTTTAGCTCTACGCGGACACGCCGGCGAACTCAGCCACGAACTTGCGCTGCGCCGACGAGAGTCCCCACG
CCGGCGCGCCGCGCACGACGAGCCGCGAGAGCAGAGCGGCCGCGGCCTCGTCCTGCGCGAGCAGCTGCTGGGCGGCGCGCTGGCGGTCGTCCTGCGACGC
GAGCGCCGCCTTCTTCACGTCCCAGGCCTGCATGAGCTGCGCGAGCTGCGTCACGTCCTGCGGCTCGGCGCGCGAGCCGGGGTGGAACGTGGCCGCGGCC
TCGGATCGCGTCTTGATGGAGCCGTAGAAGCCGCCCTGGCCCTCGTACGCCTGGCCGCCCGAGTACGTCGTGAAGGCGCGGAGCGAGGCCGGGCGAGTGG
CGGCGGTGGCCCTGGACAGCAACGTCTTGGCGAGCGCGGGCATGGCTGG