Description :
From Genome Similarity Track
Location :
contig_35:222782- 224656
Transcript NameFunction/comments
g8344.t1RAW26717.1 hypothetical protein PC110_g16886 [Phytophthora cactorum

Sequence
1874 bases(100 bases per row)
GGTGTTTGGGAGCTGGTCAAATTTGTTCTGTTTGATACCATACAATGTGAGAATCTTGATGTTTTCGCAGCTTATGGCTCTGGAGTTGAATACTCTCGTT
GAATACTCTCAACTCGCTAATCCAATTTTGCTTCGACGAACGAATGGTGTTCGGGGTCAAAGAACTGGATTTTAGTCGTGCCGGAAGTCTCTGAGTGCGT
CGCCAAGTGGTTCGAGGGCTTGGTGAGGAAATGGTTACAGAAGTTTGTTATCGTCTTTTCGACGCTGCGACCCACGAAGCGATCCCTGGGACCCAGACAG
CTTCTGTGAAACGAGTCGATGATGTCCAGGATATTGAAGATCTCTGCATCAAGATTCGTGAGCTTGCCGACGACCATCAACGGCCACGCAGAGACATTCT
AGCGAATGTTGCGCTCATGCAGATGAAGGTGCACCGGAACAGGGCGGCATATGATGCAAAGCGACGGTCGATACCATTCACAGCTCACCTGAACGGGTTT
AGAAAGGATGGAGTTAGTGCGCTCATTGTCGAGGAACCGCTACCACCGAGGGAAAGAGACGTCTACTACGAACTAGCAGCTGCCGACGGTGGTCTCGATT
TCACAGACACTAAGCATCTTCAGTCCGTCTTACGAACTTGAACAGCATCGACGACTTCAAGAAGAACGTTTTGGACTTGAGTCGCCCGCTACTCGCCGAA
TATGCGCCACATCATGTAACTGTTTATCCGGACCGGGAAACGAGTGGCGCCTTGGCGGTGGATGCCAGACTTGGGACGTATGGTGCATCAGCCGCGAAGG
CGCTGGTTGTGAAAGTGCCGTCGCGACCAAGTAGGCGGCTGAAATCAGTGTGGCATCAGACGGTGACACTTGACCCTGCTGCTTCCACACTGCCGCTCGG
TGAGGAAAGCCCAGTGTGGAGAATTGATCCGACTGCTATGGTTGGTTTTGGTATTTATGAGCTTTGCAAGAAGTTGTGCTTGTACTGTCGCGCTGACACT
GTTAGGTTGACCCGCTTCTTGCAGATCCATTGTTTTGCGGTAGCACCTCCAGTGTGTGTTCGCTTGGAAGGAAACGAGAAGATAACAATTTAACAGGAGG
AAACAAACTTACTGAATGACATGGACCTACTTCTGAATGAAGTTGAAGATACAAAGCAGTACATCGTGTTTCTTGATGGGGTTACGCAGGAACAGGACCA
GGCAGTGCGTGTTTGTATTGGCGCGAGGTAATTCTGCTATCGAAATACTACTTCGCTGGCGGGAATGTTCGCTATATGTTTCACTATCCAAAAGCGCAAG
TGATAAAACCCCTGGATGAGGCTGTCCAAGCCGCAGTGGGGACCCCATTGAGGGAGCGTATAAACACAGCTTCCTCATCGGTTACTTCAAGAAACTTTTA
GACTCGCTCGCGGCAGCGATTTTTGAGGTCAAGACGCTGGAAATTTTCTTCGTTGTGGAAAGGCAAAAGCTGCTCCCTTTCAAGTTTTCCGTGGTGACCG
GTCAAGGAAACGTGATACATTATGGATGGCAGCAGGGCGAGGAAACAGGCAAAGTGAGGCGTGTAGCCGTTGAAGGGGTCGAGACCTGGAATGTATTGAA
TTGGTGAGCAAGGACCTTAATGACTGGTACGGAATGGCCTTAGCTTTTTGGCAAAGGACACAGAAATCGTTGAAATTGATTCACTATTGTCGGACTTTTA
ACCTTTAATCCTTCTACATGGAAAAGCTGAGCTCCAAGTTGCTTCACGGGGTCGAATTCTTCAATTACATCGATACGAGAGAGTATGTGAAGTGCTTGAG
CAACTTCTAGCGATTTTTGTGGAGCTGACCGCTTGAAATGCGTCTACTGGTCCTGCTCCTGGTATTGACACCTT