Description :
From Genome Similarity Track
Location :
Scaffold_1321:2227- 4337
Transcript NameFunction/comments
Phymu_g13108hypothetical protein

Sequence
2110 bases(100 bases per row)
CGCGATCAACATGGATAATCTGGAGGACGATCCAGATCAGGAAGGGAAGTTTGCATTTTTTGTATATGTATATGGAATCAGGagtggtcgaagctgccag
aTGGTGTTCTCGAATGGCTAAGTGGTGACAGAGTGAGATCACGATacgatggcgatggaaaAGAGAAGAGAAGCGGGGATCACAAGCTAGAATTTTCAAA
GTACGCGGGAGAACGCGTGGAAGCTAAATTGAAGCTTGAGTCATGTCATATCAACGTGGAGCTTGAGCCGTTAATGGGGAATATTGCCGCATCAGGTGGA
ATCGTGGGCCATACGATTCAGACGGAGCGGGATCACGTGCttgagaagctggagctggtggataTGAAGGTCGAGTGTGAGCTGGGCTTGATCGTGTGCA
TTACGGTTGGGATCAAACCTAAATTGAGGTTGAAATTGATTTGCATTCGAGACCGAGGAAGACCTGACCTTGAATGAGCTCTGCCTGCACCTCGAGACCA
CGAACGATTTGAGTTTGAtcaagacggagatgacgcGATTGACGGTCTGGGCTCGTCTACGGGTGATTTGACGCCATTATGTACGCATTGATCTCGATTG
CACCGAATACTGTGTAGATTGCGCCTGGTCACGGTGAATTATCCAAGGTTAAGCGATGTTCAAACTTAATAACAGGTTGCACTTCGAATTAGTGTGCTAG
TTCCACTTGATCGCTCCAGATTTTACGAGATCGGGATTTGTATTGCTTAGAAGTGGATAGACGAGACTTATTACAATACGCGATCACGACAAAAAAACAC
CGCATACGTCAACGATACGTCAGTCATATTGAACTCAGCGAACCCGAAGTGAGTCACTGTGCGACACAACTTACGTGCTGGGGGCGGATGTGGTAAAGCA
CATCTCAGATGTTCGTACTTACTTGGAAATGACATCGAGATTGGTATGGTGGACCGATGGTTGCTTCTGATCGCTATGGACGACACAGACCCACCGATAC
ATTGCTCAATCCGGTGTTCACGACCCCGGATCATTGCGGATCTGGGTGGGTATAACCCGATCAAGACCCGAGTAAATGTGTTTGATAGGCTGGCTGAGGC
AAATTGTGATCTTCAGAGGATCAACATCGGCCGAATATCCAGAAGGTCGAAAGCTTGTGATcaatgatggagacgcaAGTACGACGACCACGAAGTGGGG
ATTGTCGAGGGTCCAGTTGATTTGACAGTCGTAATGAGGAGACCAACGACGATCGGCCACGATCTCCAACCTAGGCGTGATCGCCGAAGGTGATCCGGTG
CAAGCGGCAGCTAGTTGAGTGGATTGAGCATCAACGATGATTatcagctcgagctgagTGTATTGGGCGGGTGAGATGCAAAGATCAACGAAGATTGGCC
GAGAAAGGCGAACGGGAACCGATTATCTTACATTATGTCGATAAGAGCAAGGATCGATGCTCGCCAAGTGTAACCCAGATTCACGAGCAGTGGTCTCTGC
TAACCAAGTGtagtctgcagcagtggagtggCGTTCGACGATGATCAAACCAGAACGAATGTCAGGAAGGAAGGACCAAGGGTGATACCGCATGGTCAGC
CATGACTGAGCTGAGACCACGGGTGATCAGCGACCAGGGTAGTATGTCCACGATGATCCAGACGTTTCCGGGGCAGAACAGGCGAGATCAAAGGAGATCA
CACAAGATCAAGCACTGGTATATCAAGATCGAGGGAGATCAAGTTGTATTGTATGCTGAATCGTGATCGGGTATTGAGACAAGATGGCAATCCGGTATCA
AGGCAACGTGGCGGGCCAGGATCACAACATGCTGTCCATGGTTGATCGCGATCAGCGTGATcctcctcgatcgcgatcgaagATCAGTGAATGCGTGAGC
CAGTTGTGTATCCAGGtgtcaggtgatcgtaggatagcgaatcaggatgggactAGTGGACATAGGAATAACTCTAAACAGAATCGAATTCACCCTGAAC
tacacaagtgccttcgtccacgcctgGAGTCGGGAGTTATATTGGCCCATTAAGCGTCAGGAAGGTAAGGATACGTGATCTAGTGTAGTGGTTAAGTCTG
GATAATATAT