Description :
From Genome Similarity Track
Location :
contig_58:222581- 224626
Transcript NameFunction/comments
g10890.t1ETI42132.1 hypothetical protein F443_12695 [Phytophthora parasitica P1569

Sequence
2045 bases(100 bases per row)
GCGCCCAAGAAGCAGTATGAGCTGGTGGTGCAGGACGACTTCCTCGTGGTGCTGCACCCCGTGCATCCGCTGAGTCTGCAGATCGCGCGCTCGAGCGGCT
CGGACGCGTCGCTGGGGCTCGCCGTGGAGCACGTGGCGGACTCGCAGCACGTGCATGGGCGGCGCATGGCCTTCGACGCCATCTACGGCGTCTTCTGGCT
GCTACGCGGGCCCTACCTGGCAGTGGTCACGCAGTCTAAAGTGGTGGCCAAGGGCGTGGACGGCCACGAGATCCGCGCGGTGCACACGCTGGAGCTTCTG
CTTATCCCCACGCAGAACCTGCCGACGCTGACGCCGCAGCAGGAGCAGGACGAGCGCACGTACATCGACATGATCACGGGCGACATCGAGGCGCAAAAGC
TGCACTTTGCACGGGACTTGGACCTCACGCACACGCTGCAGCGTACGGCAAGTGGAAGTTGATACCTTTGGACAGTGAAAATGACGGTAGTTTACTGTCT
TGTCAGGCATTGCGGCGTTCGACGGCAGGATCGGCAGTATTGCCGAGCGCGCGGACGAGCGCTTCTTCTGGAACAAATCGCTGTGCTCGGCGTTCATTGG
TACGAGACGCTGTTGAGGGCTGGTAGGGGGATGAGACTGATACGTTGCGCTGCAGAGCAAAAGTTCTTCGAGTGGGTGACGCCCATGGTGCAGGCGCACG
TGGAGGTGACGGAGCAGCTCAAGGTGAAGGACAAGTCCTTCCGCATCTTGTACATCTCGCGAAGGTCGTGCAAGCGCCAGGGAATGCGCTTCACGATGCG
CGGCATTGACGACGATGGCAACGTCGCCAACTTTGTCGAGACAGAGCAGATCTGCATTTTTGACGACGGGAGGCAGACGTCGTTCGTGCAGATTCGGGGC
TCCATCCCCGTGTTCTGGAGCTCGCCGTTACGATGAAGTACGCGCCGAAAGTGTACCACGCCGGCGATAGCGAGCGCGACGTGGCGGCCTTCCAGAGGCA
CGCGTACCAGCTCATGGGGCTATACGGCCGCGTGTTGTTCGTGAATCTCATCGACAAGAAGAAGGAACAGCTCAAGCTAGGCGAGGCGATGGCCAAGACT
GTCGCCGACGCCGCTACCAAGGACTCGCACATCCTCGCGGCCGTGCGACTCGTTTGGTTCGATTTCCACCACGAGTGCCGCAACATGAAGTGGGGCAACC
TCGAGAAATTGATCAAGCAGGTCGACGACGACTTCCTCGACCACGGGTAAGTGCCATACCGCGCTTGGCGGTGGTTTATCAGAAGCTGATCGTGCGTTTG
TGCAGATACTTTTGCAAGGGCGCCGATGGCTCGGTCGTGAGCAAGCAGTCCGGTGTGGTGCGCACCAATTGCATGGACAACCTCGACCGCACCAACGTCG
TTCAGGTGAGTCGTTCGAAGATGTCTCCTGTTGAAGTCGACTGCTAACCGCCCCTTTGTCTCGCCAGTCGCTGTTCGGGCGGCGGAGCCTGATGTTGCAG
TTAAACGAGACCGAGGCGCTGCAAGGAAACGTGCTCAACTCGCCGTTCGAGGAGTTGGAGCGCACGTTCAAGCGCGTGTGGGGCAACAACGCCGACGCGA
TCAGCCTCTTCTACGCCGGCACGGGCGCGCTCAAGACGGACTTTACGCGCACGGGCAAGCGCACCAAGAAGGGCGCGCTCATGGACGGCTACAACTCGTG
CGTGCGCTACATCATGAACAACTTCATGGACGGCTACCGCCAGGACGTGCTGGACCTGCTGCTCGGACGTTTCTCGGTGTCGCGCAGCAAGCCGTCGCCG
TTCCAGACGGCAGGCGAGAGCCTCGAGTCGGTGCTGGCCAAGCTCATGGGGCTCGTGGTCGCCTTCTTCCTCGTGGAGACGTACCGCAGCAGCGGCCAGA
GCTTCTTCTTCGAGCGGCTCGTGCGGTCGGTGCTGCTGACGCTGCTCATCTGCGCGGGCGTGTTCAGCGTGCTGGTCAAGAAGGGCAACTCGCTGGGCCA
GAAGCTGGTGCGGCTGCCGAGTTTGCGCCCGCAAGACGGCTGCAT