Description :
From Genome Similarity Track
Location :
Scaffold_90:222576- 230211
Transcript NameFunction/comments
Physo_140844hypothetical protein
Physo_140845hypothetical protein
Physo_140846hypothetical protein
Physo_140847hypothetical protein
Physo_140848hypothetical protein

Sequence
7635 bases(100 bases per row)
CCACTTCGCCGACGGCCTCGGCCGCCACGCCCGCCACGTCCCCGACCGCGACCGCGACCGCCGTCGTCTACGTGCAGAGCAGCAGCCGCCCCACCATCAC
CAGCAGTTCCAGCAGCGGAGCGCTGGTGGCCAGCGGAGGCCGCCGACGCGGCCGCAGACACAAGAGCTACTCCGAGTCGGCGCTGCGCCTCGAGCGCATG
CTGGCCCCCGCCGCGCCGGCCAGCGGCGCGGCCCGCGCGCGGCCCTACTCGGCGGGCGACGAGGTCGACCTCGTGCGCACGGTCACCATCTCGGGCTACT
CCAAGAACAGCCACGGCACGTGGGTGTTCAAGGTGGACGTCGGCGGACCCAGCGACACCAACGCCTACGTCGTGCGCCGCCGCTTCACGGACTTCAAGCT
GCTGCACGAGGGGCTGTCCGAGCTGTCCGAGCTGCCGGAGCTGCCGCCACATGGCATCGTGTCGGTCTTCCAGATGTTCGTCTCGCCTGACAAGCTGCTT
ACCGCGCGCGCGGCGAGACTGCAGGAGCTGCTGCTGGTGATCCACGCGCACCCGCGGCTGTGCAAGAGCGCGGCCTTCAGCAAGTTCATCGGCAAGAACC
CCAGCAGCTACGACGCCGGCTACGTGAGCCTGTCGGGCTACGAGGTCCCGAAGAGCGACAGGCAGCTCCGACTGAGCCCCGCGGGCTCCTTCGACACCAG
CTACTCGGTGTAAGCAGCAGCAGCAGTCCAGAGATGAAGATGATGAAGATGAAGAAGAGAGAGAACAGTGGAGAACCACAGAGAAGGAAGAGCAGAGAGA
GAGAGAGGGAGAGAGATGGAAGGAAGGAAGGTCGATTCGATCGAAGAAGGCACCGGTAACACCCGACAACAACAGAGAGACGACACCACACACGTACAAT
AGGTGGAGCTACCTGGAGGAGAAGAGAGTAAATTATTTATTTACTGAGTATACTGGAGTAGGGTGCAATACACATGTAACCATGAGTGCGAACGCTGACG
TCTTGCCTTGTCTTATGTATCTTGCTGACCCAGCCTCTCGTCGTGTGCTGGTGGTGGGGCGCCCTGCCTGCGCGTCCGACGGCGCGAGGAGAAAGCTGCC
CGCTCTGCTCCAGACAGCCAGGCGAGCGGTCAATTGCTGACACCCTGCGCGTGGGACTGGCCCGGCGGCGGGAAGCAGTGCAGCAGGCGAGACCTCCGAT
ATCGGACACCGAGCTGTTCGCAGCGCTGCAGCAATCACCGCTTCTTGTCCACAAATTGCCTGTTGCCTGTGCTTGCTGAGCATTGCCCCCAGACCCCCAA
GCCTGTCGCCGAGGTGACGCTCAAGTCCATGCCAGCGACTGCATAGCGCATGTCGCCAGCAACCTCTTTTTTATGCCGTATGCAAGGTCGCGAGAATGAT
GGTAGTGTGTAACCTTGGGGTACACGACGGTTACGCCACCACTTCTGCTTATCGCACAGGAAACATGCTGCCGATCCTGCGCCACTCGGCGCGCAGCTTC
TCGTCCGCCGGCATCAAGCGCGCCAAGCCCATCCGCGTCAAGAAGAGCGAGGCGCGGCGTGTTGTTCCGGACGCGCCAAAGCTGAGCAACGCGCTGACGG
AGGCGCCCGCCCCGCCGCCGCCGGCGAACCCGTTCGTGCACTCGGAGCAGCAGCCCCCGCAGACCTTTGGCGGGGTTATGAAGGAGGTAAGCGCGTTTGG
CTGACCATTCACTAGTAGTCTACGTGCATAGGACTGATGAGGTATTCTCGTGTACTGTGATGCAGAGTTTCCTGTGGGGTATGGGCATGGCCGTCGCGTT
CTCGGTTGTCGGCATTGTTTTCAGCAGCATGGAGGAGGTATGAGTGACTGTCTGCGTGCAGCTTCACAGTGGGGCCCTGCTGGTGCGTGCTATTGTAGTT
AACACGTGTGTCGCTGCTGCTGCTATACGACAGACGACGGCTCCAGGCCAATTCGAGGGCAGCGTGGTGATGCCAGCAGGAGACCAGCGCGAGCAGGAGT
GAGCTACGTAGCTACATGCACGGTAACTGCAAGTTGCCGTTCCTGCGTGTTCAGCAATGCATTGCTGCTCATCGCGGAGCGCATCGCCGTGTTAAACGCA
GGTTCAAATTGAAGTGTAGCTGTGCCAGGCTATCCAAATTACCATTCATTCAATTTCTAGTCAGAAATGCGCGGCGGCATCCGCCAGCCGCCGCTACTTG
CTTACTATATTACCGTCTCGCGGTCTGGTTGTGCCCCTCACCGCTCGCTCTTCCGACGGAGCTCGCAGAGGCAGGCTGGCGCGCCACCAGAACCTCGCCA
CGAGAAGCGTCACTCGTCTCAGAGTGGCTTTAGTCCCAGTCGTCGTCCGAGTCTGCGTCCGCGTTCGACTCTTCGTACTCGACGTGGATACGCCGCATCG
CCATTGCATTCGTGATGGCTTCGTTGATGGAGCCAGCCTGCGTAAGCGCTGGAGGTGGCGGCGGAGGCTTCGCGGCGGCCGAGGAAGCACCAGAAGTACC
TGCTGGGTCCCCGTCGCCGGTCTTCTTCAGCTGAGTACCCTGCCGAATCGCCGCAAGCAGGTCACCACGACCACCTGCAAAGGGATTCGGGCGTCCTGGA
GGTAACCCAGTCACGGCCGGCTTTGGTGGTTCGACGGGGCGAGGAGGAGCCGCCAAACTTGCTCTTGAACTCGCTCGAGAGCTCAACCGTGAACGCGACC
GACTCTTCTTGCCGCGCAGAGTATCTTCGGGGACAGCGCCGATAACGCTGCTGGACAGCTCGGCTGTTTTCGGCTTCCTCCGTTGAGTTGACGACGCTGC
AGACTCACGCCGCTGCTGCCGTGTAACCAGTTTTGGCGTGTCGACCGACGTATCCGAGTCCGACTCGGGGTCGGAGTCCGAGTCGTCCAAGCCAAAGAGT
CCCTTCGACGCTCTCGGCTTGGCAGCTCGGGCAGGGGGGCTTTCTTGTCGAGAAGAATCGGGCGACACCACTTGCTCCTTCTTCGGTAGAGGTGCAACGG
GGCTTCTCGGAGGTCGGCCATTAGACTGAGCACCATTTGCTACACTTCCGTTGGAGTTTTGGCCGTTCGCCAATGCGCGCGAAAAGGCGCCGTCGATATG
GTACTCGAACTGGAACCGCTCGCTCGACAGAACCCCAGGTAAGGCCACCAGCTGCTGTAAGTACAGGCGGAACTCCTGGGCTCGCTTCTCCATGTTTTCA
GGCTTCGTGTTATTGCGCAAGCGGTGCTTTGAAGGGAACTTTGGCAGCGCTGTGCTCGGGAAAGCTGAGGTCAGTCGTGTGTGGATCTCCTCAAATTCCG
AGTATGTAAATGAGAAGCTGTGCTCCAAGTTCCCGAACTGAAGCATGAAAGTGAAGACACCGGTCGACTTTTTGCCTTCAGTGCGCAGAGCAGAGGATAT
GAACACCACGACGACGCTAGGACCAGAGCCGCCTGCCCCCATGTTGTTCGTCGTGGCACCCCTCGGACTTGTTGGTTCGATTTTGCGAGGCTGGGCAAAG
AATGATGTGCCTGCTTGCAACATGCACCTGTGGGTTAGCCAAACATTGCAAAAGACCGACATCAGAAAATATTGGATTCGTACCGTTGTCAGAATCGGAG
TCGCTTGATACATCCTCATCGCTGCTTACGGATGGCGCAGGGGCGCTCTTCTTCACTGGCGTTGGGCGCGAGTCCACACTCAAATCACTTGAACGCATGC
TAGTAGACGCACGGGAGGTACTGTTCGGCGCCTTGCTCTTTCGCCCACCGACACCGAACAAACCAGTGTCGGAATCATCGTCTTCGTCACTGCTACTGTC
GTCAAATAGACCCCTGCGTCCGGAATTCGCCTTCGACTTTAGTTTAGAAGCAGGAGCTTGAGTGCTCTCGCCGCCCATTGCCTTCTTCAAGATCTCCTTT
CCTTCAGCACTTAGCTGAGAATCGCGTTTCCGATCGCGCACCTTGCCATTGACGGGGGCGCCTGCCACCGGGCTAACAGCGCTGCTGCTAACGCTCATTT
CCTCGACAGTGTCAGCACGGTTACGCCGAATCGCAGCAAGACTAGCCGCGAAAGCGTTCGCCATCGACGGTTCTGGGGCCGGTGAACTCGTACTTCCGTT
CGTTCGGGTGTTATCCGTCTTGGGCTTTCGACTCGGCGCCGCATAAGACGCAGTCGTCACTGAGCTCATGGTAGATCCAAACGAGTCTCGTCGGCGGCTC
GCTCTTGACGCGGGCTTGGGCCTTCCCCCACCTAAGATGGCAGCCAGATTGTCCTGCATGTTCTGCTTGCTTTTGTCCGCACTTGAAATCCGGCGACTGC
CTTGCGAGAAGGAAGATCTAGACGGCACGGGGTCTTCATCCCGATCAAATGCGAACGAGTCGAACGACGAGCTTCGTAGGCTGCTGCTGGATCTCGAAAG
TCGGGATTCCCGCTCGTTGAAACTCTGGTGGTCAAATAGTGGGGGAGGCGGAGGTGGCGGGATACTCATCGACGCTCGGGACGACATGGAGACGCGGGAA
TTACTAGCTGACCAGCGCATCGGCGGCGGTGGCGGCGGAGGAGGAGGAGCATTGCCCATACCCCCGTCGTGTCTGGATCCAGTTACCGACGAAACAGAAG
AAAGCCGCGACGACATCGACGAGCTGTCCGACATGTCGCTTCCAGAGGAGCCTAGACGCACCGGCGCGTCATTGTGAACAACACCACCGACCTCGAAAAC
TGCGCACAAGATCAAAACACATTAATTCACAGATACTCACTTCCTCGAGTGGGCCAAGAAAATACAAAGTGTACTTACACTGTCCAGGGGGAGGCAGTTC
CACTCGAACCTTGGTCTTCTGCTCCACAATCCTCGTGTGCAACGGCTGCACGTTGTCCGTCTTTCCTCCCGCCGCTTCTTCGAGCCGTCGGCGATACGCC
GCCTTGTTCACTCTGCCCGTCGTGGGGGCCTGTCGACGCTGCAGCCTCAGCTTCCTCTTCTCCAGCATCCTGGCCGTGTCGTCATCGAGCGAGCCGAGGC
CGTCCACGCGCTCCAGCGGCGTCATGTTGTTAATCTCCTCCTCCCGCGCCAGCAGGCGGTCCTGCTCCTCCTTGATCATTCTGGCCTTCTTCTCCTTCCA
CTTGCGGATCTTCTCCTCGCGCTCCTCCTGCAGCCGCTTCTCCTCCTTCTTCACGCGGCGTCGCTCGCGCCGAACCTCCTCGCCCGCCGCGCTGTGCGGA
TCCAGCACCGCTGCAACATCATCAAAAGTACCCAATTCCCGTCAGCAATTGGGTCCAAATCTTCCGCCATTAGGCGACGCACGTACCCATAAATCCACGA
CACCATTTCTCCTGATCCACGCGGTTGAACGCCGCCAGGTGCATGCGCGGCTTGGCGTGGCGCTCCACCTTGAGCTCCAGCCCGTACGAGTCCGCCTTGA
GCAGGCCGTCGCCGTCCCAGCCGGCGAACCCCAGCAGGTAGGCGATGTCTACCTTGTTGCGCGCCTCGGGGTCGCTGCCGTCGAAGAACTCGAGCTTGCG
GTTCATGGTGAGCACCACGTAGAGCTCCTTGAGGCCCTTGCCGCCGACCAGCGCCGGCCTCCACTGCGGGGGCTTGGCGCCCTCCGCGCGCGGGGACGCA
GCCCCGTCGCGCTTGACGAGCAGGAAGCCCTCGTGCACGACCCAGGACCCGCCGCCCATGACTGCGCTTTTGTGCGGGTTTTCTTTGTCTGAAGACAGTC
ACGAGGAACGCTTGTCCGGGCTGAAGCGCCCCCCTGCTTTGCATGAAACAGTCTTGATGGGGCGGAGTGTCCGGCGGGAAGTGCCCCCGTTTGACTCAAG
TTGAGCTGGATGCCATAGTGGAACCAAGTGAAGTGAAGGAGGGAATAAGCGTTTGCGACACCTATTTTTGCGACACACACGTATTTTTGGACCTTGATGA
CGCGCTAATCGGGGTCGGAACTTGCCTAAACTGTTTAGGCCGCACGCTACTGCTACTAGCTGTGCAGCAGCGACTGCGCTTGACTGAGCTCCTCGTACAG
CGCCAGGAACTTGCTCTTGTCCACGTCGAAGCTGAGCTCGTGCCCTGCCTCGCCTGGTATCGATGCCGCCGCCACGCCGCAATCCATCACCGGCTGGTCC
AGCTTCAACTTGAGCTTCACCGTCGTGGACGGAGCCTCCTCCAGCTTCCACTCGACTTGCTCGACGTGAGGAAACTGCGCGGTAAAGTGAAGTATATGTG
ATGGTGAGTGCAATGTGCTGAAGGAGCGATCGATCGAGAAGCCGCACCTGAAAGCGTCGGGAGCGCTGTTGGTTCTGGATGTGTACACGCTGTTCCTCGT
AGCTCTGAGCAATGGCGTCGGCTGATACCTGCTGCATGCCAAGTTGTTGCAGCTCCTCGACAAGATCTGCGCGGTCTGCGTCGTACTTGGCAGCGTGCGT
CAACATGAACCGTAGAGCAGCAACAGCAGCCTGGAACGGAATGGCAACCAGACCCTCGTCAGGTCAACATGAACCGCAGCAAAACAATGTAATCCTGCTC
AACCTTCGCGTCTGCAGGGTCCTGAAATAATGTCTGCGTCCGATCCAGCTCCTGCAGCCAACGCAACCAACATCGCTAAGCTCTCCACCTTCCCACGCTC
TGCACTCATGGCTTTCAACAAACCTGCACTCCGATATCCGTCCCAATAGCTTCACACATAGCAGCGAGGTCATCATGCGTCTATGCATGTAGTTTGATAA
GCTTGTTAGCGCCGATCATTGAAGCCGCAGCGAAGCCGCAAGCGCACCACTTTGCTCTGCTCCCCTGACAGCAGCGGCACCTCGGCCAGCAGCCAGTCGG
GCGGCTCCAGTCCACCGCAGAACCTGAATTTCTGCGGCACAACAGCATTTAATTAGAGCCGCACGCATAACTGCAGCCTTATGCAGCTCGTGGAGGCGGT
ATATCACCCGGAGAAGCCGCCTCAAGCGGGTCACACTGGCACGCACCATTTTCGCCGATCAAAAGGGAAATCGGATCTGATCCCCCTCAGAATCTAAGAT
TTGGATCGCTTATTTAGAAGTTTCAGAATCTAAGTCACTACGTTTTCGATCTCGAAAGGTCGTGGCAGCTATTTGCAGACATCCCGGGACTTGACAGCGT
GACGACAGTCCTCTTGTGACCCAGGTAGACGCAGGCGATGGCTGTCACGGCGCTGGATTCGCCTCAGCGCCGCAAGGATGCCCCCGGCGAGGACAAGGCG
GGCGAGTTCGCCTTGCTGCTGGTGCAGGAGTGGCTGGTCGCGTGCAAGCTCGAGTCCACGGCGCGGTGTCTCGTCGACGAGTGCGCGCGAGCAGAGCGCA
ACGTGCCTGCAAGAGTAGTGTGGAATCAAATGGTGGAGAACTTGGGCTTTGGGCCTCGGAGTCCGGCCACTGGGGGCAAGCGCGGCGGTGGGAACACGAC
GCTACTGGAAGCGGTGGTGAGAAGAGCCGTCGAGCATCACGAGAAGGGCATTGCACAGGCCACCCGCAACCACGCGCTGGTTCCGCACCAGCAGGTCGTG
GTTATGAGCAAGAAGAGGGAGCTGAGGTTTGTCGCCAAGCGGTCCCTGCCCAGGTCAAAGTCTGCAGCGCCCAGCAGCAGCAACAACAACGCACAAGACC
GCTCGCCCGAGGTGTCGAGTCCTCCATCATCGCAC